We narrowed to 1,966 results for: rigi
-
Plasmid#170268PurposeExpresses LexA_DBD-iLight-msfGFP under J23116 promoter and mCherry under ColE promoter with a LexA408 operator in bacteria.DepositorInsertiLight
TagsmsfGFPExpressionBacterialMutationTo design iLight for expression in bacteria, a fu…PromoterpJ23116Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Chronos-tdTomato]
Plasmid#84481PurposeAAV-mediated expression of Chronos-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [ChrimsonR-GFP]
Plasmid#84480PurposeAAV-mediated expression of ChrimsonR-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterhuman synapsin promoterAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR-BLINK2
Plasmid#117075PurposeBLINK2 gene in pDONR vector for Gateway cloning systemDepositorInsertBLINK2
UseGateway cloning systemMutationglutamine 112 changed into aspartate (original LO…Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-TFIIE
Plasmid#171083PurposeCo-expresses human TFIIE. The resulting plasmid was used to generate a single expression construct encoding 2 subunits, with His-tag on TF2E1.Originally from MN Gonzalez, was submitted with permissionDepositorTagsHisExpressionBacterialPromoterT7 promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-fd [ChrimsonR-tdTomato]
Plasmid#84483PurposeAAV-mediated expression of ChrimsonR-tdTomato under the Syn promoter, in floxed/forward (Cre-dependent) manner. Cre turns gene off. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationChrimson K176R mutantPromoterhuman synapsin promoterAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish ArcLight Q175
Plasmid#53616PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertZebrafish ArcLight-Q175 (tpte Aequorea victoria, Zebrafish, Synthetic)
ExpressionMammalianMutationDr-VSD contains R153Q mutation and an amino acid …PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PBK
Plasmid#23782DepositorInsertPBK (PBK Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-fd [Chronos-GFP]
Plasmid#84482PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/forward (Cre-dependent) manner. Cre turns gene off. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [ChrimsonR-GFP]
Plasmid#108273PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α promoter (1.1kb short version)Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Chronos-GFP]
Plasmid#84485PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α, 1.1 kb long (short version)Available SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMIG-AVITEV- hNFATc1/aA
Plasmid#74057Purposeretroviral expression plasmid for human NFATc1/aA with N-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc1, isoform alpha-A (NFATC1 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianMutationmutation G1157A [R235Q] and the silent mutation C…PromoterpMSCV-LTRsAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLY54
Plasmid#130923PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA2B2 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA2B2, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY9
Plasmid#130907PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-2G6 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-2G6, and PtetAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY59
Plasmid#130927PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::MCP controlled by promoter J23106), and the reporter part (PpspA-2G6 with sfgfp::ASV).DepositorInsertsdcas9
tetR
sfgfp
pspFΔHTH::MCP
UseSynthetic BiologyTagsASV tag and MCP (MS2 coat protein)ExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-2G6, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY57
Plasmid#130926PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA5B5 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA5B5, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY56
Plasmid#130925PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA4B4 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA4B4, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY55
Plasmid#130924PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA3B3, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY53
Plasmid#130911PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only