We narrowed to 3,140 results for: cat.3
-
Plasmid#171923PurposeExpression of human RNF216 (Triad3A) codon optimized for E. coli and insect cells. Catalytic RBR-helix construct suitable for activity assays.DepositorInsertE3 ubiquitin-protein ligase RNF216 (RNF216 Human)
UseTags3C protease cleavage site and 6x-His tagExpressionBacterialMutationcodon optimised for expression in E. coliPromoterT7Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR Human CASP9 -1
Plasmid#198419PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter ProteinDepositorInsertHuman CASP9 Specific gRNA (CASP9 Human)
UseCRISPRTagsCas9/Orange Fluorescent Protein ReporterExpressionMammalianMutationPromoterU6; CMVAvailable sinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
TagBFP2-INPP4BC842A-CAAX
Plasmid#116858Purposeinactive plasma membrane targetted PI(3,4)P2 phosphataseDepositorInsertINPP4B (INPP4B Human)
UseTagsHRAS(172-189) and TagBFP2ExpressionMammalianMutationcatalytic cysteine 842 changed to alaninePromoterAvailable sinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
CCR3-Tango
Plasmid#66240PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorInsertCCR3 (CCR3 Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO2 ts1
Plasmid#115853PurposeAGO2 knockdownDepositorInsertAGO2 shRNA (AGO2 Human)
UseLentiviralTagsExpressionMutationPromoterSFFVAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO2 ts2
Plasmid#115854PurposeAGO2 knockdownDepositorInsertAGO2 shRNA (AGO2 Human)
UseLentiviralTagsExpressionMutationPromoterSFFVAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorUseCRISPRTagsExpressionYeastMutationPromoterSNR52Available sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDR217
Plasmid#113872Purposeexpression of Cas9 programming sgRNA9 and sgRNA10 targetting MPH2-3 and MAL11 respectivelyDepositorInsertsgRNA9-MPH2-3 sgRNA10-MAL11
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
SL536
Plasmid#49942PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertRHOXF2 Rhox homeobox family member 2 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO1 ts3
Plasmid#115847PurposeAGO1 knockdownDepositorInsertAGO1 shRNA (AGO1 Human)
UseLentiviralTagsExpressionMutationPromoterSFFVAvailable sinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
AA021
Plasmid#215929PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; DR_v0 [EnAs]; sgCD4_v1 [EnAs]; DR_v1 [EnAs]; sgCD4_v2 [EnAs];
UseCRISPR; FragmentTagsExpressionMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-dnVamp3-P2AT2A-EGFP-caax
Plasmid#190154PurposeExpresses dominant-negative Vamp3 (rat Vamp3 AA 1-81) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp3 (Vamp2 Rat)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only rat Vamp3 AA #1-81PromoterMBPAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOUPc-Rh159-HA
Plasmid#179344PurposeAll-in-on "tet-on" 3G lentiviral vector plasmid encoding rhesus cytomegalovirus Rh159 (NK cell evasion protein) with a C-terminal HA tag fused to its cytoplasmic tailDepositorInsertRh159
UseLentiviral; All in one tet-on lentiviral vector (…TagsHA tagExpressionMammalianMutationPromotertet responsive element 3GAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-hRNF216(457-784)
Plasmid#171922PurposeExpression of human RNF216 (Triad3A) codon optimized for E. coli and insect cells. Catalytic helix-RBR-helix construct suitable for activity assays.DepositorInsertE3 ubiquitin-protein ligase RNF216 (RNF216 Human)
UseTags3C protease cleavage site and 6x-His tagExpressionBacterialMutationcodon optimised for expression in E. coliPromoterT7Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-ProteinA
Plasmid#105788PurposeExpression of your protein of interest in fusion with two IgG binding domains of Staphylococcus aureus protein A at the C-terminus (cleavable by TEV) (PMID: 3507693, 10504710). Protein purification.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-ProteinAExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
BCR/ABL P190 transgenic construct
Plasmid#38185DepositorUseConstruct for making transgenic miceTagsExpressionMutationPromotertruncated mouse MT promoterAvailable sinceOct. 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKK-MBP-TEV
Plasmid#105771PurposeExpression of your protein of interest in fusion with MBP at the N-terminus (cleavable by TEV). The maltose binding protein tag allows convenient purification of proteins (PMID: 22442034, 19935684).DepositorTypeEmpty backboneUseFlp-in competentTagsMBP-TEVExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-MBP
Plasmid#105787PurposeExpression of your protein of interest in fusion with MBP at the C-terminus (cleavable by TEV). The maltose binding protein tag allows convenient purification of proteins (PMID: 22442034, 19935684).DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-MBPExpressionMammalianMutationPromoterAvailable sinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cntn3-AP-His
Plasmid#71941PurposeExpresses the extracellular region of the Contactin 3 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn3 (Cntn3 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only