We narrowed to 2,445 results for: control GFP
-
Plasmid#22780DepositorInsertYpet
ExpressionMammalianMutationControl for intermolecular Rac1 biosensor FRET. S…Available SinceDec. 18, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMM0617
Plasmid#128993PurposeloxP-KIURA3-loxP preassembled entry vectorDepositorInsertKanR-ColE1 URA 5' homology-ConLS'-sfGFP dropout-ConRE'-loxP-KIURA3-loxP-URA3 5' homology
ExpressionYeastAvailable SinceOct. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
ptagBFP-LacI
Plasmid#103839PurposeFlourescent marker for lacO arraysDepositorInserttagBFP-LacI
ExpressionMammalianMutationLacI: C19T (silent, L7L), T264C (silent, A88A), C…PromoterSV2Available SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
ptagBFP-LacI-NLS-VP16
Plasmid#103837PurposeTranscription activator (transactivation domain of viral VP16 protein) that is constitutively recruited lacO arraysDepositorInserttagBFP-LacI-NLS-VP16
ExpressionMammalianPromoterSV2Available SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCKtheoRaj12m
Plasmid#69943PurposepSTC2,TheoHHAzRaj12mut,cisRaj12-sfGFP, kanRDepositorInsertpSCKtheoRaj12m
UseSynthetic Biology; Psc101 origin of replicationAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
XLone-BSD SARS-CoV2 N P2A mCherry
Plasmid#154398PurposePiggybacTransposon-based tunable and temporal expression control of SARS-CoV2 N and mCherryDepositorInsertSARS-CoV2 N Protein (N SARS-CoV2)
UsePiggybacTagsmCherryExpressionMammalianPromoterTRE3GAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
GeneWeld Vectors for Targeted Integration Using CRISPR/Cas9
Plasmid Kit#1000000154PurposeVectors for integration using short homology and CRISPR/Cas9 to produce knockout alleles with and without a fluorescent reporter, fusion proteins with endogenous genes, and Cre drivers.DepositorAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgNeg1
Plasmid#166998PurposeLentiviral expression of negative control sgRNA for CRISPRi knockdownDepositorInsertNegative control sgRNA 1
UseCRISPR and LentiviralPromoterU6Available SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgNeg2
Plasmid#166999PurposeLentiviral expression of negative control sgRNA for CRISPRi knockdownDepositorInsertNegative control sgRNA 2
UseCRISPR and LentiviralPromoterU6Available SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCK302
Plasmid#87768PurposeAs pCK301 (E. coli rhaBAD promoter upstream of sfGFP, sfGFP can be replaced with any gene of interest), but rhaS cloned downstream of ampR, which allows non-metabolisable inducer L-mannose to be usedDepositorInsertsPrhaBAD-sfGFP
rhaS from E. coli with its native RBS from E. coli
UseSynthetic BiologyTags6xHis TagExpressionBacterialPromoterPrhaBAD rhamnose-inducible promoter from E. coli …Available SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET51b(+)_ALFA-tag-SNAP
Plasmid#136628PurposePlasmid encoding the bacterial expression of ALFA-tag asa SNAP-tag fusionDepositorInsertEGFP-NbALFA
TagsHisx10 and StrepExpressionBacterialPromoterT7Available SinceFeb. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHS-435
Plasmid#195470PurposeLentiviral Integratable Constitutive super IL-2 cytokineDepositorInsertpEF1a-Super IL-2-2A-EGFP
UseLentiviralExpressionMammalianAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHS-439
Plasmid#195471PurposeLentiviral Integratable Inducible superIL-2 cytokine using synZiFTR ZF3DepositorInsert8X ZF3 BS - ybTATA - super IL-2 - 2A -EGFP
UseLentiviralExpressionMammalianAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-puro_FlnaABD-TS-16flag
Plasmid#234868PurposeExpresses control FlnA-based tension sensor that lacks dimerization domain and therefore does not report tension.DepositorInsertFlnA Actin binding domain, Ig 15, GFP-F40-RFP, FlnaA Ig 16
UseLentiviralTagsGFP, RFP, FLAGExpressionMammalianPromoterCMVAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP617_αGCN4-mCherry
Plasmid#211785PurposeSunTag counterpart binding domain, aGCN4, fused to catalytically inert mCherry control, with GFP selectionDepositorInsertSnoopCatcher-DNMT3A
Tags2xOLLASExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
KBB372
Plasmid#185084PurposeGAL::Rfa1[330-621]-GFP under control of GAL1 promoterDepositorInsertRFA1
TagsGFPExpressionYeastMutationRfa1 amino acids 330-621PromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PS Intein Bid
Plasmid#242024PurposeBlue-light-induced protein cleavage: apoptosis via Bid activation.DepositorInsertPS Intein Bid
ExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only