We narrowed to 158 results for: SHH
-
Plasmid#31233DepositorAvailable SinceAug. 23, 2012AvailabilityAcademic Institutions and Nonprofits only
-
shh10
Plasmid#64867PurposeThis plasmid can be used in the triple transfection method of AAV vector production. It supplies the replication proteins from AAV2 and the engineered shh10 capsid protein.DepositorInsertshh10 cap
UseAAVMutationI319V, N451D, D532NAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.shHmga2
Plasmid#32399DepositorAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX_sgRNA_entry (CJT32)
Plasmid#181782PurposeExpresses ShHELIX containing a nicking I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 ShhN
Plasmid#37680DepositorAvailable SinceJuly 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pY2ShHELIX_sgRNA_entry (CJT30)
Plasmid#181781PurposeExpresses Y2-ShHELIX containing a nicking Y2 I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertY2-nAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
ExpressionBacterialMutationY2-nAniI = F13Y, S111Y, K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOEM1_pCMV:hShh-pPH:vsvged
Plasmid#111156PurposeBaculovirus rescue vector, VSVGED pseudotype, hShhDepositorInserthShh (SHH Human)
UseBaculoviral rescue shuttle vectorExpressionInsect and MammalianMutationwtPromoterCMVAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
shha-pCRII
Plasmid#68962Purposefor antisense probe, NotI w/ Sp6DepositorInsertshha (shha Zebrafish)
Available SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga1#3
Plasmid#122289PurposeKnockdown for mouse Hmga1DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga1#1
Plasmid#122288PurposeKnockdown for mouse Hmga1DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga2#3
Plasmid#122291PurposeKnockdown for mouse Hmga2DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSico-shHDAC2
Plasmid#194983Purposeconditional knock down HDAC2DepositorInsertshHDAC2
ExpressionBacterialAvailable SinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT22i2Shh24G4FER3(#1041)
Plasmid#184072Purposecyclofen-inducible GAL4 activation in zebrafish permanent transgenicDepositorInsertGal4bdFF-ERT2
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-Shha2.4Available SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga2#2
Plasmid#122290PurposeKnockdown for mouse Hmga2DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBS hShh (CT#401)
Plasmid#13996DepositorInsertShh (SHH Human)
ExpressionBacterialAvailable SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE-SHH
Plasmid#134350PurposeTargeting vector for site specific integration of doxycycline inducible expression of full length human SHH cDNA into human AAVS1 locusDepositorInsertSHH (SHH Human)
ExpressionMammalianAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only