We narrowed to 370 results for: gag pol
-
Plasmid#14887DepositorInsertgag / pol
UseRetroviralExpressionMammalianAvailable SinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCF153_Gag-Pol
Plasmid#225961PurposeCMV-Intron-GagPol (FMLV). Expresses FMLV (Friend Murine Leukemia Virus) Gag-Pol for VLP production.DepositorInsertCMV-Intron-GagPol (FMLV)
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
SIV_Gag_Pol
Plasmid#236243Purpose3rd generation SIV-based lentiviral packaging plasmid; Contains SIV Gag and PolDepositorInsertSIV Gag and Pol
UseLentiviralAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
gag-P3-pol
Plasmid#211374PurposePackaging plasmid for v3b PE-eVLP productionDepositorInsertMMLVgag-P3-pol
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
gag-COM-pol
Plasmid#211373PurposePackaging plasmid for v3b PE-eVLP productionDepositorInsertMMLVgag-COM-pol
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-CMV-gagpol
Plasmid#35614DepositorInsertMLV gag and pol genes
ExpressionMammalianAvailable SinceJuly 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
gag-MCP-pol
Plasmid#211370PurposePackaging plasmid for v3 PE-eVLP productionDepositorInsertMMLVgag-MCP-pol
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS2M-PH-gagpol-D64V
Plasmid#166031PurposeExpression of bacteriophage-derived MS2 coat protein fused HIV-1 Lentiviral Gag-Pol at N terminal with a HIV-1 protease cleavage signal between MS2 and Gag-Pol.DepositorInsertMS2-Gag-Pol
UseLentiviralMutationD64V mutation within the integrase within PolAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
v5 eVLP gag-pro-pol
Plasmid#228466PurposeExpresses MMLVgag-pro-pol(Q226P) for producing v5 eVLPsDepositorInsertMMLVgag-pro-pol(Q226P)
ExpressionMammalianMutationQ226PPromoterCMVAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFH2.30_Gag-MCP-dpol-T2A-eGFP
Plasmid#205538PurposeExpress HIV Gag-MCP-dpol-T2A-eGFPDepositorInsertHIV Gag-MCP-dpol
ExpressionMammalianMutationpol frameshift sequence recodedPromoterCMVAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFH2.17_GagZip-MCP-dpol-P2A-eGFP
Plasmid#205532PurposeExpress HIV GagZip-MCP-dpol-P2A-eGFPDepositorInsertGag-MCP-dpol
ExpressionMammalianMutationNucleocapsid replaced with leucine zipper, pol fr…PromoterCMVAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS NL4-3 envFS eGFP Δgag/pol
Plasmid#101343PurposeDeletion from the start of gag until 229 bases before the cPPTDepositorInsertNL4-3
UseLentiviralMutationdelta GagPolAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
gS gag LV
Plasmid#12327DepositorInsertgag/pol
UseLentiviralExpressionMammalianMutationThe CypA binding region of the WT gag was replace…Available SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
gB gag LV
Plasmid#12328DepositorInsertgag/pol
UseLentiviralExpressionMammalianMutationThe CypA binding region of the WT gag was replace…Available SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
MMLVgag-3NES-Cre
Plasmid#207252PurposeGeneration of CreVLPs when used in conjunction with MMLV gag-pol during productionDepositorInsertMMLVgag-3NES-Cre
ExpressionMammalianPromoterCMV promoterAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWN_U6-TRAC-miniGag
Plasmid#228960PurposeminiEDV production plasmid. Expresses the miniGag polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag
UseCRISPRExpressionMammalianAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV GAG
Plasmid#234992PurposeFor production of Viral like particles (VLPs) by expressing the MLV GAG protein in mammalian cellsDepositorInsertGAG
ExpressionMammalianMutationDeleted polymerase coding sequenceAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BIC-Gag-DDX3
Plasmid#233687PurposeExpresses a fusion between the Murine Leukemia Virus Gag polyprotein and the human DDX3 protein to produce virus-like particles loaded with DDX3 and deliver it to target cells.DepositorInsertDEAD-box helicase 3 (DDX3X Human)
UseRetroviralTagsGag (Murine Leukemia Virus)ExpressionMammalianPromoterhCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only