Showing: 41 - 60 of 4730 results
-
Plasmid#84615PurposeHR donor to integrate UAS1B8TEF(136)-hrGFP-CYC1t into A08 locusDepositorInserthrGFP
UseSynthetic BiologyTagsExpressionYeastMutationPromoterUAS1B8-TEF(136)AvailabilityAcademic Institutions and Nonprofits only -
pHR_D17_hrGFP
Plasmid#84616PurposeHR donor to integrate UAS1B8TEF(136)-hrGFP-CYC1t into D17 locusDepositorInserthrGFP
UseSynthetic BiologyTagsExpressionYeastMutationPromoterUAS1B8-TEF(136)AvailabilityAcademic Institutions and Nonprofits only -
pHR_MFE1_hrGFP
Plasmid#84617PurposeHR donor to integrate UAS1B8TEF(136)-hrGFP-CYC1t into MFE1 locusDepositorInserthrGFP
UseSynthetic BiologyTagsExpressionYeastMutationPromoterUAS1B8-TEF(136)AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_AXP
Plasmid#84608PurposeIntroduces DSB at AXP locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterUAS1B8-TEF(136)AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_XPR2
Plasmid#84609PurposeIntroduces DSB at XPR2 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterUAS1B8-TEF(136)AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_A08
Plasmid#84610PurposeIntroduces DSB at A08 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterUAS1B8-TEF(136)AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_D17
Plasmid#84611PurposeIntroduces DSB at D17 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterUAS1B8-TEF(136)AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_MFE1
Plasmid#84612PurposeIntroduces DSB at MFE1 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterUAS1B8-TEF(136)AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
UseTagsExpressionMutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …PromoterAvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
UseTagsExpressionMutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pF-N-HiBiT-template
Plasmid#200882Purposetemplate for N-terminal HiBIT-taggingDepositorInsertHiBIT-linker
UseTagsExpressionMammalianMutationWTPromoterAvailabilityAcademic Institutions and Nonprofits only -
HaloTag-WDR5
Plasmid#200880PurposeMammalian expression of human WDR5 with N-terminal HaloTag fusionDepositorInsertHaloTag-WDR5 (WDR5 Human)
UseTagsExpressionMammalianMutationWTPromoterAvailabilityAcademic Institutions and Nonprofits only -
WDR5-HaloTag
Plasmid#200881PurposeMammalian expression of human WDR5 with C-terminal HaloTag fusionDepositorInsertWDR5-HaloTag (WDR5 Human)
UseTagsExpressionMammalianMutationWTPromoterAvailabilityAcademic Institutions and Nonprofits only -
pNIC28-HiBIT-WDR5
Plasmid#200883PurposeBacterial expression of N-terminal HiBIT-tagged human WDR5 proteinDepositorInsertHiBIT-WDR5 (WDR5 Human)
UseTagsExpressionBacterialMutationWTPromoterAvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV1)
Viral Prep#112677-AAV1PurposeReady-to-use AAV1 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV2)
Viral Prep#112677-AAV2PurposeReady-to-use AAV2 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV5)
Viral Prep#112677-AAV5PurposeReady-to-use AAV5 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV8)
Viral Prep#112677-AAV8PurposeReady-to-use AAV8 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV9)
Viral Prep#112677-AAV9PurposeReady-to-use AAV9 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV Retrograde)
Viral Prep#112677-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)AvailabilityAcademic Institutions and Nonprofits only
Showing: 41 - 60 of 4730 results