32,387 results
-
Plasmid#247939PurposeExpression of human LONP1 with methionine 115 as its first residue (mature mitochondrial-matrix localized form) Pore Loop 2 mutant (Y599A)DepositorInsertLONP1 (LONP1 Human)
Tags6xHisExpressionBacterialMutationencodes aa 115-959, with Y599APromoterT7Available SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET20b-His6-LONP1
Plasmid#247937PurposeExpression of human LONP1 with methionine 115 as its first residue (mature mitochondrial-matrix localized form)DepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET20b-His6-LONP1-Walker B mutant (E591A)
Plasmid#247938PurposeExpression of human LONP1 with methionine 115 as its first residue (mature mitochondrial-matrix localized form) and Walker B mutant (E591A)DepositorInsertLONP1 (LONP1 Human)
Tags6xHisExpressionBacterialMutationencodes aa 115-959, with E591APromoterT7Available SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521(K35E/Y145R)-myc
Plasmid#196241PurposeN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialMutationamino acid 35 lysine is replaced with glutamic ac…Available SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB053
Plasmid#217835PurposeBacterial expression of human AP3B1 (1-677) and AP3M1 AP-3 core hemicomplexDepositorTagsGSTExpressionBacterialMutationRemoved residues 678-1094 from AP3B1Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
WNV NS2B-NS3 protease (catalytically active, self cleave); aliases: West Nile Virus NS2B-NS3 fusion protein
Plasmid#204795PurposeBacterial expression of a fusion of West Nile NS2B-NS3 proteinsDepositorInsertWest Nile NS2B-NS3 fusion
ExpressionBacterialAvailable SinceAug. 29, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
NBla_1.2_EmrE_TMD4_3P_G90V_G97V
Plasmid#207847PurposeBLaTM-System; Antiparallel negativecontrol EmrE_TMD4_3P_G90V_G97V in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_EmrE_TMD4_3P
Plasmid#207846PurposeBLaTM-System; Antiparallel positive control EmrE_TMD4_3P in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_GpA_wt
Plasmid#207842PurposeBLaTM-System GpA wt positive control in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
CBLa_1.2_GpA_wt
Plasmid#207843PurposeBLaTM-System GpA wt positive control in CBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251_ Ptrc.x.tetO2::D-HicDH
Plasmid#185456PurposeCDS of D-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 under the control of the synthetic promoter Ptrc.x.tetO2 and the RBS BBa_B0030 in pSEVA251 plasmid.DepositorInsertD-HicDH from Lactobacillus paracasei DSM 20008
ExpressionBacterialPromoterPtrc.x.tetO2Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Ki67-mCherry
Plasmid#183748PurposeExpresses EGFP-Ki67-mCherryDepositorInsertMKI67 (MKI67 Human)
TagsKi-67 with N-terminal EGFP tag and Ki-67 with C-…ExpressionBacterial and MammalianPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPET-PKR/PPase
Plasmid#42934DepositorAvailable SinceApril 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBS mShh (CT#258)
Plasmid#13999DepositorInsertShh (Shh Mouse)
ExpressionBacterialAvailable SinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
pT7II-2N3Rtau
Plasmid#249551PurposeRecombinant protein synthesis of 2N3R isoform of human TauDepositorInsertTau (2N3R) (MAPT Human)
ExpressionBacterialAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSC5GGv1
Plasmid#194645PurposepSC5 Golden-Gate Cloning Plasmid (BsaI - Site 1)DepositorTypeEmpty backboneUseSynthetic Biology; Diatom expressionExpressionBacterial and YeastAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSWAP_Entry_HB
Plasmid#184868PurposepSwap plasmid part with HB homology armsDepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
LentiGuide-Puro-P2A-EGFP_mRFPstuf
Plasmid#137730PurposeExpresses customizable S. Pyogenes sgRNA from U6 promoter and PuroR-P2A-EGFP from EF-1a promoter. Stuffer contains mRFP from a bacterial promoter, enabling simple visual quality control step of sgRNADepositorTypeEmpty backboneUseCRISPR, Lentiviral, Mouse Targeting, and Syntheti…ExpressionBacterial and MammalianAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDFDuet-MKK6-EE
Plasmid#82718PurposeExpresses constitutively active human MKK6. Multiple cloning site 2 is empty.DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only