33,539 results
-
Plasmid#203882PurposepHI1 with insertion of monomeric red fluorescent protein (mRFP)DepositorInsertmonomeric red fluorescent protein
UseSynthetic BiologyExpressionBacterial and YeastAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGCNK58
Plasmid#202461PurposePlasmid for the expression of the basic region and leucine zipper domain of the Saccharomyces cerevisiae transcription factor GCN4 in bacterial cellsDepositorInsertResidues 226-281 of Sacchromyces cerevisiae GCN4 plus an N-terminal Met-Lys extension (GCN4 Budding Yeast)
ExpressionBacterialAvailable sinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pR540
Plasmid#207885Purposetemplate for 2 gRNA amplificationDepositorInsertscaffold-pU6
ExpressionBacterialAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHS1477
Plasmid#205970PurposeMWEE01000013 Cas5-HNH operon (E. coli codon optimized) with His14-tagged Cse2 in pET45b(+)DepositorInsertCas5-HNH all proteins, with His-tagged Cas11
Tags14xHis on Cas11ExpressionBacterialPromoterT7Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHS1398
Plasmid#205971PurposeMWEE01000013 Cas5-HNH crRNA expression in pCOLADuet-1DepositorInsertCas5-HNH crRNA
ExpressionBacterialPromoterT7Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHS1801
Plasmid#205966PurposeJAGBLH010000220 Cas8-HNH full system (E. coli codon optimized) in pACYCDuet-1 with Lac promotersDepositorInsertCas8-HNH proteins and CRISPR array
ExpressionBacterialPromoterLac (proteins), pJ23119 (crRNA)Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHS1232
Plasmid#205969PurposeMWEE01000013 Cas5-HNH operon (E. coli codon optimized) + CRISPR array in pACYCDuet-1 Lac promotersDepositorInsertCas5-HNH proteins and CRISPR array
ExpressionBacterialPromoterLac (proteins), pJ23119 (crRNA)Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
IVT-MCP-MMLV-RT
Plasmid#207457Purposein vitro transcription of mRNADepositorInsertMCP-RT
ExpressionBacterialAvailable sinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
mTB3-Myc tag
Plasmid#210205PurposeType 3 phage-display vector that contains kanamycin resistance and displays the Myc-tag at the N-terminus of mature protein III.DepositorInsertMyc-tag
ExpressionBacterialAvailable sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
PdnaK-IR3-IR3-Bxb1-CadR-pZa
Plasmid#204686PurposeCadmium responsive genetic circuitDepositorInsertBxb1 (Bxb1p45 Synthetic)
UseSynthetic BiologyTagsCadRExpressionBacterialPromoterInducible, HspR is its repressorAvailable sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
P25-pZE-SUMO-PbTTA
Plasmid#204634PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized pbTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-PbTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
HNRNPCL1_RRM_pGEX
Plasmid#135116PurposeRecombinant expression of HNRNPCL1 with dual-affinity tagDepositorAvailable sinceNov. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+pPGI+NAT+tNOS+ku70 insD (SBE217)
Plasmid#195049Purposeintegration cassette for ku70 deletion and expression of NAT gene under pPGI for characterizationDepositorInsertNAT
ExpressionBacterialPromoterpPGIAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV298
Plasmid#204957PurposeAMA1 plasmid with Aspergillus optimized Mad7 and pyrG selection markerDepositorInsertsMad7
pyrG
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and native pro…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDIV297
Plasmid#204820PurposeAMA1 plasmid with amdS selection markerDepositorInsertamdS
UseFungal expressionExpressionBacterialMutationtwo silent mutations (nt177T>C, nt879C>T)PromoterAspergillus nidulans trpC promoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pETDuet1_CoiC_CoiSA
Plasmid#208762PurposeTwo coi synthase CoiC and CoiSA, for the co-expression of CoiA1 in E.coli.DepositorInsertsCoiC
CoiSA
ExpressionBacterialMutationsingle nucleotide insertion (C70) at RBS of CoiCPromoterT7Available sinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJS96
Plasmid#207588PurposeGFP-TonBH20A expressionDepositorInsertGFP-TonBH20A
ExpressionBacterialMutationH20AAvailable sinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJS65
Plasmid#207587PurposeGFP-TonB expressionDepositorInsertGFP-TonB
ExpressionBacterialAvailable sinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJS61
Plasmid#207585PurposeGFP-TolA expressionDepositorInsertGFP-TolA
ExpressionBacterialAvailable sinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only