8,173 results
-
Plasmid#232153PurposeMPS1 from Candia parapsilosis codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Rhizoclosmatium globosum
Plasmid#232152PurposeMPS1 from Rhizoclosmatium globosum codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Malassezia globosa
Plasmid#232151PurposeMPS1 from Malassezia globosa codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastMutationLikely not full proteinAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Candida auris
Plasmid#232150PurposeMPS1 from Candida auris codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Human
Plasmid#232149PurposeMPS1 from Human codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1 (TTK Human)
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Candida glabrata
Plasmid#232148PurposeMPS1 from Candida glabrata codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Schizosaccharomyces pombe
Plasmid#232147PurposeMPS1 from Schizosaccharomyces pombe codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1 (mph1 Fission Yeast)
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Candida albicans
Plasmid#232146PurposeMPS1 from Candida albicans codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00045
Plasmid#232904PurposePlasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.DepositorInsertMSN5 (MSN5 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat-ADE2
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-K.l.LEU2
Plasmid#229229PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-NatMX6
Plasmid#229231PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-TRP1
Plasmid#229228PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
PAF23
Plasmid#223171PurposeExpresses yeGFP under control of CTR1 promoter and terminatorDepositorInsertgreen fluorescent protein
ExpressionYeastPromoterSaccharomyces cerevisiae CTR1Available SinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PAF24
Plasmid#223172PurposeExpresses VC83_00191-yeGFP under control of CTR1 promoter and terminatorDepositorInsertCopper Transporter
TagsStreptagII and yeGFPExpressionYeastPromotersaccharomyces cerevisiae CTR1Available SinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymScarletI3
Plasmid#224106PurposeExpressing ymScarletI3 in yeastDepositorInsertymScarletI3
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
P415 ymiRFP680
Plasmid#224109PurposeExpressing ymiRFP680 in yeastDepositorInsertymiRFP680
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-ymBaojin-URA3
Plasmid#224081PurposeYeast tagging vector to create a gene fusion with yeast optimized mBaojin with URA3 selectionDepositorInsertymBaoJin
TagsymBaoJinExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymBaojin
Plasmid#224085PurposeExpressing ymBaojin in yeastDepositorInsertymBaoJin
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
P415 ymTurquoise2
Plasmid#224093PurposeExpressing ymTurquoise2 in yeastDepositorInsertymTurquoise2
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yemiRFP670-SpHis5
Plasmid#224098PurposeYeast tagging vector to create a gene fusion with yeast optimized emiRFP670 with SpHis5 selectionDepositorInsertyemiRFP670
TagsyemiRFP670ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 yemiRFP670
Plasmid#224103PurposeExpressing yemiRFP670 in yeastDepositorInsertyemiRFP670
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymiRFP680
Plasmid#224105PurposeExpressing ymiRFP680 in yeastDepositorInsertymiRFP680
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
P415 yemiRFP670
Plasmid#224107PurposeExpressing yemiRFP670 in yeastDepositorInsertyemiRFP670
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Amyloid β42-c_myc
Plasmid#225223PurposeYeast optimized human Amyloid β42 fused with aga2 protein gene under gal1 promoter for the expression of Amyloid β42 in yeast surface display.DepositorInsertsTagsHA Tag and c-myc TagExpressionYeastPromoterGAL1Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb12567
Plasmid#219927PurposePrCYC with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter CYC
ExpressionYeastAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb12566
Plasmid#219926PurposePrDGA with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter DGA
ExpressionYeastAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only