We narrowed to 121 results for: HBB
-
Plasmid#26639DepositorInsertHbb (hbb Borrelia burgdorferi)
ExpressionBacterialAvailable sinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorPublicationAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xms2-2x3’UTR
Plasmid#122946PurposeFor expressing SaCas9 mRNA with one copy of MS2 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-MS2-HBB 3' UTR
UseAAVExpressionMammalianAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZB
Plasmid#86194Purposebeta Globin NMD construct with and without PTC under Bi-directional TET on promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAUseTet onExpressionMammalianMutation39TER in beta Globin in MCS IIPromoterTet onAvailable sinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJP-HBB-nLuc
Plasmid#175431PurposeExpresses nLuc with 5' leader of human beta globin (HBB) in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnLUC plus 5' HBB leader
ExpressionMammalianPromoterCMVAvailable sinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro
Plasmid#192681PurposeLentiviral expression of sgRNA targeting mHbb-bh1promoter to activate mouse Hbb-bh1 transcriptionDepositorInsertMouse Hbb-bh1 activating gRNA #1 (Hbb-bh1 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSA073 HBB_IVS2-Cas9-BFP
Plasmid#249134PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-Cas9-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
PonA-BI-Gl-WT-18xPP7-WT-24xMS2 (Switch)
Plasmid#189793PurposeExpress wild-type beta-globin genes bi-directionally under ponasteron A inducible promoter in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertbeta-globin (Hbb Mouse, Human)
ExpressionMammalianPromoterPonasterone A inducibleAvailable sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA128 A2UCOE-HBB_IVS2-Cas9-BFP
Plasmid#249152PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-Cas9-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC57-HBB-nLuc
Plasmid#175432PurposeUsed to generate IVT RNA for translation extractsDepositorInsertHBB-nLuc
UseLuciferaseExpressionBacterialPromoterT7Available sinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD685 HBB_IVS2-EnAsCas12a-BFP
Plasmid#249158PurposeOverexpression of EnAsCas12a-BFP with HBB IVS2 intron in 5' UTR with blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-EnAsCas12a-TagBFP (HBB Synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA075 Cas9-BFP-HBB_IVS2
Plasmid#249136PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 3' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP-HBB_IVS2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA072 Cas9-HBB_IVS2-BFP
Plasmid#249133PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron after Cas9 coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-HBB_IVS2-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD687 A2UCOE-HBB_IVS2-EnAsCas12a-BFP
Plasmid#249160PurposeOverexpression of EnAsCas12a-BFP with HBB IVS2 intron in 5' UTR with blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-EnAsCas12a-TagBFP (HBB Synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA074 Cas9-BFP/HBB_IVS2/BFP
Plasmid#249135PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within BFP coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP/HBB_IVS2/TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA076 Cas9/HBB_IVS2/Cas9-BFP
Plasmid#249137PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within Cas9 coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9/HBB_IVS2/Cas9-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xPP7-2x3'UTR
Plasmid#122947PurposeFor expressing SaCas9 mRNA with one copy of PP7 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-PP7-HBB 3' UTR
UseAAVExpressionMammalianAvailable sinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCR2.1_HBB_N
Plasmid#87847PurposepCR2.1-based plasmid holding a 309-bp fragment containing the exon-1-exon-2 splice border of normal human β-globin mRNADepositorInsertHomo sapiens hemoglobin subunit beta (HBB), Normal cDNA fragment (Exon1/2) (HBB Human)
ExpressionBacterialAvailable sinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPD292 PPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-BFP
Plasmid#249156PurposeOverexpression of PPH-T2A-dCas9-NFZ-P2A-BFP with HBB IVS2 intron in PPH coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-mTagBFP2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA144 HBB_IVS2-Cas9-BFP with core cHS4 insulators
Plasmid#249154PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Flanked by cHS4 core insulators. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-Cas9-TagBFP with core cHS4 insulators (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1_HBB_A
Plasmid#87848PurposepCR2.1-based plasmid holding a 328-bp fragment containing the exon-1-exon-2 splice border of aberrant HBB[IVSI-110(G>A)] human β-globin mRNADepositorInsertHomo sapiens hemoglobin subunit beta (HBB), Aberrant cDNA fragment (Exon1/19nt mispliced Intron1 + Exon2) (HBB Human)
ExpressionBacterialMutationHBB(IVSI-110) β-thalassaemia misplicing mutation …Available sinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPonA-BI-Gl NORM-LacZA TER- LacZB
Plasmid#86212Purposebeta Globin NMD construct with and without PTC under Bi-directional Ponasterone A inducible promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAUsePonasterone a inducible promoterTagslacZA or lacZBExpressionMammalianMutation39TER in beta Globin in MCS IIPromoterPonasterone A inducibleAvailable sinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
MKC83_HBB(HBBreg-HBA1)
Plasmid#232409PurposeAAV production plasmid for HBB UTRs vector from Fig. 3 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBB UTRs flank HBA1 cassette.DepositorAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKC-4.06
Plasmid#112084PurposeNMD sensor: pCMV-3XFLAG-Fluc-betaglobin (39PTC)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert3XFLAG firefly luciferase-beta-globin 39PTC (HBB Mouse, Photinus pyralis, Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable sinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKC-4.04
Plasmid#112085PurposeControl for NMD sensor: pCMV-3XFLAG-Fluc-betaglobinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert3XFLAG firefly luciferase-beta-globin (HBB Mouse, Photinus pyralis, Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable sinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgRNA HBB
Plasmid#128120PurposeCo-expresses sgRNA HBB, SpyCas9 scaffold (F+E) and GFP (transfection marker)DepositorInsertsgRNA HBB + GFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRSV/U6Available sinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFRT-PonA-BI-Gl-WT-24xMS2-WT-18xPP7 (WW)
Plasmid#189791PurposeExpress wild-type beta-globin genes bi-directionally under ponasteron A inducible promoter in mammalian cellsDepositorAvailable sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFRT-PonA-BI-Gl-GFP-PTC-mCherry-WT (5FP-WP)
Plasmid#189795PurposeExpress GFP/mCherry linked wild-type and PTC-containing beta-globin bi-directionally under ponasteron A inducible promoter in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertbeta-globin (HBB Mouse, Human)
ExpressionMammalianPromoterPonasterone A inducibleAvailable sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFRT-PonA-BI-Gl-GFP-WT-mCherry-WT (5FP-WW)
Plasmid#189794PurposeExpress GFP/mCherry linked wild-type beta-globin bi-directionally under ponasteron A inducible promoter in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertbeta-globin (HBB Mouse, Human)
ExpressionMammalianPromoterPonasterone A inducibleAvailable sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
modified pcAT7-Glo1
Plasmid#160996PurposeSplicing reporter backboneDepositorInserthemoglobin subunit beta (HBB Human)
ExpressionMammalianMutationRepeated intron 1 with 40 nucelotide deletionPromoterCAGAvailable sinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Beta-Globin-WT
Plasmid#130700PurposeExpresses Beta-Globin WT NMD reporterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBeta Globin (HBB Human)
ExpressionMammalianPromoterPcmvAvailable sinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFRT-PonA-BI-Gl-WT-24xMS2-PTC-18xPP7 (WP)
Plasmid#189792PurposeExpress wild-type and PTC-containing beta-globin genes bi-directionally under ponasteron A inducible promoter in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertbeta-globin (HBB Mouse, Human)
ExpressionMammalianPromoterPonasterone A inducibleAvailable sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-RLuc-BGG-PTC_E
Plasmid#146191PurposeMammalian Expression of BGG-PTCDepositorInsertBGG-PTC (HBB Human)
ExpressionMammalianAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-RLuc-BGG-WT_E
Plasmid#146192PurposeMammalian Expression of BGG-WTDepositorInsertBGG-WT (HBB Human)
ExpressionMammalianAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
MLM3747
Plasmid#49965PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-6 (HBB Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MLM3739
Plasmid#49959PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-4 (HBB Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MLM3743
Plasmid#49962PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-5 (HBB Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1246
Plasmid#49960PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1238
Plasmid#49957PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
C-Terminal Split Cas9 with GyrA intein
Plasmid#58694PurposeExpresses truncated C-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with N-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized C-Terminal S. pyogenes Cas9 with GyrA Csplit Intein
UseAAV and CRISPRTagsGyrA Csplit Intein and NLSExpressionMammalianPromoterCBhAvailable sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
JA1290
Plasmid#49968PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
JA1261
Plasmid#49963PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1252
Plasmid#49956PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 with GyrA intein
Plasmid#58693PurposeExpresses truncated N-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized N-Terminal S. pyogenes Cas9 with GyrA Nsplit Intein
UseAAV and CRISPRTags3xFlag, GyrA Nsplit Intein, and NLSExpressionMammalianPromoterCBhAvailable sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
JA1280
Plasmid#49969PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1272
Plasmid#49967PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1266
Plasmid#49966PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1229
Plasmid#49955PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1217
Plasmid#49954PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only