We narrowed to 105 results for: HBB
-
Plasmid#232409PurposeAAV production plasmid for HBB UTRs vector from Fig. 3 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBB UTRs flank HBA1 cassette.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pPMEL-hbb
Plasmid#239863PurposeTemplate for in vitro transcription of PMEL (gp100), including native signal peptide, flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertFull premelanosome coding sequence including native signal peptide, flanked by human haemoglobin beta 5' and 3' UTRs (PMEL Human)
ExpressionMammalianMutationValine to Glycine change is at amino acid 26 of n…PromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNluc-hbb
Plasmid#239753PurposeTemplate for in vitro transcription of nanoluciferase flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertNanoluciferase flanked by human haemoglobin beta 5' and 3' UTRs
UseLuciferasePromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a Hbb
Plasmid#26639DepositorInsertHbb (hbb Borrelia burgdorferi)
ExpressionBacterialAvailable SinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
sgRNA HBB
Plasmid#128120PurposeCo-expresses sgRNA HBB, SpyCas9 scaffold (F+E) and GFP (transfection marker)DepositorInsertsgRNA HBB + GFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRSV/U6Available SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1_HBB_N
Plasmid#87847PurposepCR2.1-based plasmid holding a 309-bp fragment containing the exon-1-exon-2 splice border of normal human β-globin mRNADepositorInsertHomo sapiens hemoglobin subunit beta (HBB), Normal cDNA fragment (Exon1/2) (HBB Human)
ExpressionBacterialAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1_HBB_A
Plasmid#87848PurposepCR2.1-based plasmid holding a 328-bp fragment containing the exon-1-exon-2 splice border of aberrant HBB[IVSI-110(G>A)] human β-globin mRNADepositorInsertHomo sapiens hemoglobin subunit beta (HBB), Aberrant cDNA fragment (Exon1/19nt mispliced Intron1 + Exon2) (HBB Human)
ExpressionBacterialMutationHBB(IVSI-110) β-thalassaemia misplicing mutation …Available SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHBBAD113
Plasmid#121912PurposeCharge-Introduced NpuDnaBC39 inteinDepositorInsertCI-NpuDnaBC39 intein
TagsGB1-His6ExpressionBacterialMutationS110K, I111KPromoterParaAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBBAD168
Plasmid#121916PurposeOth-NpuDnaBC39 inteinDepositorInsertOth-NpuDnaBC39 intein
TagsGB1-His6ExpressionBacterialMutationI111K, E116KPromoterParaAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pL8N_RB610-HBB_X1
Plasmid#191521PurposeExpression of nuclear ZF-DdCBE in mammalian cells (N-terminal DddAC, Right)DepositorInsertZF-DdCBE RB610-HBB X1
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL5N_LT32-HBB_X1
Plasmid#191520PurposeExpression of nuclear ZF-DdCBE in mammalian cells (N-terminal DddAN, Left)DepositorInsertZF-DdCBE LT32-HBB X1
ExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIL6-PMEL-hbb
Plasmid#239868PurposeTemplate for in vitro transcription of PMEL (gp100), with signal peptide replaced by the IL6 signal peptide, flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertFull premelanosome coding sequence with IL6 signal peptide, flanked by human haemoglobin beta 5' and 3' UTRs (PMEL Human)
ExpressionMammalianMutationValine to Glycine change is at amino acid 26 of n…PromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIL6-Nluc-hbb
Plasmid#239843PurposeTemplate for in vitro transcription of secreted nanoluciferase, with interleukin 6 signal peptide, flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertSecreted nanoluciferase, with interleukin 6 signal peptide, flanked by human haemoglobin beta 5' and 3' UTRs
UseLuciferasePromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-HBB-nLuc
Plasmid#175432PurposeUsed to generate IVT RNA for translation extractsDepositorInsertHBB-nLuc
UseLuciferaseExpressionBacterialPromoterT7Available SinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJP-HBB-nLuc
Plasmid#175431PurposeExpresses nLuc with 5' leader of human beta globin (HBB) in mammalian cells.DepositorInsertnLUC plus 5' HBB leader
ExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPMEL-Nluc-hbb
Plasmid#239862PurposeTemplate for in vitro transcription of secreted nanoluciferase, with signal peptide from PMEL, flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertSecreted nanoluciferase, with signal peptide from PMEL (gp100), flanked by human haemoglobin beta 5' and 3' UTRs
UseLuciferasePromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC84_HBB(HBA1reg-HBA1)
Plasmid#232410PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBA1 UTRs flank HBA1 cassette.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
KRD9_HBA1(HBA1reg-HBB)
Plasmid#232402PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank HBA1 cassette. HAs are ~400bp each.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
KRD22_HBA1(HBA1reg-HBB-longHAs)
Plasmid#232403PurposeAAV production plasmid for HBA1 long HAs vector from Figs. 3-6 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank full HBA1-2A-YFP cassette. HAs are ~900bpDepositorExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC62_HBB(HBA1reg-HBA1-2A-YFP)
Plasmid#232408PurposeAAV production plasmid for HBA1-2A-YFP vector from Fig. 2 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBA1 UTRs flank full HBA1-2A-YFP cassette.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSA073 HBB_IVS2-Cas9-BFP
Plasmid#249134PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-Cas9-TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA075 Cas9-BFP-HBB_IVS2
Plasmid#249136PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 3' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP-HBB_IVS2 (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA072 Cas9-HBB_IVS2-BFP
Plasmid#249133PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron after Cas9 coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-HBB_IVS2-TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD685 HBB_IVS2-EnAsCas12a-BFP
Plasmid#249158PurposeOverexpression of EnAsCas12a-BFP with HBB IVS2 intron in 5' UTR with blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-EnAsCas12a-TagBFP (HBB Human, Synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
NG0888 pCI-TPI-PTC48-HBB
Plasmid#65802PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
TagsHBB (beta-globin 3'UTR for probe binding)ExpressionMammalianMutationpremature stop codon at 48PromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSA074 Cas9-BFP/HBB_IVS2/BFP
Plasmid#249135PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within BFP coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP/HBB_IVS2/TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD687 A2UCOE-HBB_IVS2-EnAsCas12a-BFP
Plasmid#249160PurposeOverexpression of EnAsCas12a-BFP with HBB IVS2 intron in 5' UTR with blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-EnAsCas12a-TagBFP (HBB Human, Synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA076 Cas9/HBB_IVS2/Cas9-BFP
Plasmid#249137PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within Cas9 coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9/HBB_IVS2/Cas9-TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA128 A2UCOE-HBB_IVS2-Cas9-BFP
Plasmid#249152PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-Cas9-TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
MKC106_HBB(HBA1reg-HBA1-IRES-tEPOR)
Plasmid#232411PurposeAAV production plasmid for HBA+tEPOR vector from Figs. 4-6 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBA1 UTRs flank HBA+tEPOR cassette.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro
Plasmid#192681PurposeLentiviral expression of sgRNA targeting mHbb-bh1promoter to activate mouse Hbb-bh1 transcriptionDepositorInsertMouse Hbb-bh1 activating gRNA #1 (Hbb-bh1 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSA144 HBB_IVS2-Cas9-BFP with core cHS4 insulators
Plasmid#249154PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Flanked by cHS4 core insulators. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-Cas9-TagBFP with core cHS4 insulators (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD292 PPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-BFP
Plasmid#249156PurposeOverexpression of PPH-T2A-dCas9-NFZ-P2A-BFP with HBB IVS2 intron in PPH coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-mTagBFP2 (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
MLM3739
Plasmid#49959PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-4 (HBB Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3747
Plasmid#49965PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-6 (HBB Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3743
Plasmid#49962PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-5 (HBB Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3727
Plasmid#49961PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
VC388
Plasmid#49958PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1246
Plasmid#49960PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1238
Plasmid#49957PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3733
Plasmid#49964PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1261
Plasmid#49963PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1290
Plasmid#49968PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
JA1252
Plasmid#49956PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1280
Plasmid#49969PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1272
Plasmid#49967PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1266
Plasmid#49966PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1229
Plasmid#49955PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only