We narrowed to 973 results for: plasmids spcas9
-
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-nSpCas9-NG-P2A-EGFP (KAC999)
Plasmid#185914PurposepCMV and pT7 plasmid encoding human codon optimized ABE8e A-to-G base editor with nickase SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABE8e-nSpCas9-NG-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9-NG=D10A/L1111R/D1135V/G1218R/E1219F/A1322…PromoterCMV and T7Available SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-nSpCas9-NG-P2A-EGFP (KAC1164)
Plasmid#185919PurposepCMV and pT7 plasmid encoding human codon optimized ABE8.20m A-to-G base editor with nickase SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABE8.20m-nSpCas9-NG-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9-NG=D10A/L1111R/D1135V/G1218R/E1219F/A1322…PromoterCMV and T7Available SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCamKII-Cre-pU6-SpCas9gRNAentry
Plasmid#210391PurposeAAV plasmid encoding the CamKII promoter driving Cre expression, along with SpCas9 gRNA entry cassette (RFP dropout)DepositorInsertAAV-(ITR)-pCamKII-NLS-Cre-WPRE-bGHpA-(rev)-SpCas9_gRNA-BsmBI_RFPcassette-hU6-(ITR) (NJA158)
UseAAV and CRISPRExpressionMammalianPromoterCamKII promoter for Cre, human U6 promoter for Sp…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-C9orf72
Plasmid#83439PurposeExpresses Cas9 and a gRNA targeting C9orf72DepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dSpCas9
Plasmid#92113PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-hGeminin
Plasmid#199344Purposemodified version of the eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA plasmid (addgene #86613) where the C-terminus of the eSpCas9 enzyme was fused to amino acids 1 – 110 of human GemininDepositorInsertATP1A1 G3 sgRNA+user-specified sgRNA+enhanced specificity Cas9 (1.1) (addgene 86613) with cas9 fused to hgem fragment 1-110) (GMNN S. pyogenes)
Tagscas9 c-term fused to hgemenin 1-110 fragmentExpressionMammalianMutationcas9 c-term fused to hgemenin 1-110 fragmentPromotercbhAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_NPM1_G6
Plasmid#178091PurposeExpresses the NPM1 G6 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with NPM1_mNeonGreen_Donor to tag NPM1 with mNeonGreen. pX330-like plasmid.DepositorInsertNPM1 G6 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-deSpCas9
Plasmid#92114PurposeExpression plasmid for human codon-optimized dead/inactive increased fidelity eSpCas9 (1.1) (without U6-sgRNA coding sequence)DepositorInsertdead/inactive eSpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840A, K848A, K1003A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dHeFSpCas9
Plasmid#92116PurposeExpression plasmid for human codon-optimized dead/inactive increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive HeFSpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, N497A, R661A, Q695A, H840A, K848A, Q926A, K…PromoterCbhAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCAS9n(BB)-2A-puro DNM1, A
Plasmid#107795PurposegRNA vector for knock-in gene editing at human DNM1 locusDepositorInsertgRNA targeting human DNM1
UseCRISPRExpressionMammalianAvailable SinceMay 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCAS9n(BB)-2A-puro DNM1, B
Plasmid#107796PurposegRNA vector for knock-in gene editing at human DNM1 locusDepositorInsertgRNA targeting human DNM1
UseCRISPRExpressionMammalianAvailable SinceMay 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-(sgRNA-T2)-Chimeric_BB-CBh-hSpCas9
Plasmid#223323PurposeHuman codon optimized Cas9 expressing plasmid that carries the sgRNA T2 from Mali et al., 2013 (10.1126/science.1232033).DepositorInsertSpCas9 and sgRNA-T2 (cas9 )
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
NFATc3-CRISPR-gRNA#exon3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124288PurposesgRNA against human NFATc3DepositorInsertNFATc3 nuclear factor of activated T cells (NFATC3 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
NFATc4-CRISPR-gRNA#exon5-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124290PurposesgRNA against huiman NFATc4DepositorInsertNFATc4 nuclear factor of activated T cells (NFATC4 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
NFATc4-CRISPR-gRNA#exon3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124289PurposesgRNA against human NFATc4DepositorInsertNFATc4 nuclear factor of activated T cells (NFATC4 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-HF1-plus
Plasmid#126768PurposeExpression plasmid for human codon-opt. increased fidelity SpCas9-HF1-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1DepositorInsertSpCas9-HF1-plus
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; Q695A; Q926A; amino acids 1005-1013 replac…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-T2A-Puro_h53BP1_gRNA_D
Plasmid#110302PurposeExpresssion of Cas9-T2A-puromycin resistant gene and a gRNA targeting exon 10 of human 53BP1DepositorInsertp53-binding protein 1 (TP53BP1 Human)
ExpressionMammalianAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only