We narrowed to 6,180 results for: cas9 expression plasmid
-
Plasmid#121842PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven xCas9(3.7) gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA
Plasmid#73796PurposepRS416 Ura marked Cen/Ars plasmid with dCas9-Mxi1 under Tef1 promoter, and tet-incucibile RPR1 promoter with NotI cloning site adjacent to gRNADepositorInsertsdCas9-Mxi1
Tet Repressor
Structural gRNA for S pyogenes
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1, pRPR1(TetO), and pTef1Available SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA3
Plasmid#99736PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Pblu-AAVS1-Cas9-p300-M2rtTA-AAVS1
Plasmid#112261PurposeDonor plasmid with a Cas9-p300 expression cassette, a M2rtTA expression cassette, a T2A-puro selection cassette, and two gRNA recognition sequences at both ends of the whole insertion DNA fragment.DepositorInsertspCas9-p300 (EP300 Human, Synthetic)
ExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLL7 lenti-dcas9-3xflag-blast
Plasmid#112133Purposelenti vector encoding dcas9-3xflag with T2A Blastcidin resistance marker (EF1a-NLS-dCas9-3Xflag-T2A-Blast-WPRE)DepositorInsertdCas9(D10A, N863A)-T2A-Blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A mutants in Cas9PromoterEF1aAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLL8 lenti-D10Acas9-3xflag-blast
Plasmid#112134Purposelenti vector encoding D10Acas9-3xflag with T2A Blastcidin resistance marker (EF1a-NLS-D10ACas9-3Xflag-T2A-Blast-WPRE)DepositorInsertD10Acas9-3xflag-blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A mutant in Cas9PromoterEF1aAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
Plasmid#78606PurposepZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2DepositorInsertCMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoter173CMV, U6Available SinceDec. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only