We narrowed to 17,755 results for: por
-
Plasmid#166952PurposeLentiviral plasmid expressing HA-tagged KIF5A protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pLV-EF1a-KIF5AR280H-HA-IRES-Puro
Plasmid#166953PurposeLentiviral plasmid expressing HA-tagged KIF5A R280H protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-LAMP1-HaloTag
Plasmid#164209PurposeExpresses HaloTag tagged LAMP1 under CMV promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD292 PPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-BFP
Plasmid#249156PurposeOverexpression of PPH-T2A-dCas9-NFZ-P2A-BFP with HBB IVS2 intron in PPH coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-mTagBFP2 (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHR-Fzd4 subtype NGS Wnt
Plasmid#159625PurposeExpress Fzd4 subtype NGS Wnt in mammalian cellsDepositorInsertFzd4 subtype NGS Wnt
UseLentiviralTagsHis tagExpressionMammalianAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a-L274GMmMetRS-T2A-mCherry
Plasmid#220800PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistanceDepositorInsertMars1 (Mars1 Mouse)
UseLentiviralTags2xFLAG and T2A-mCherryMutationmutation in MetRS to change aa 274 from L to GPromoterEF1aAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC35F6
Plasmid#132073PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC35F6 (C2orf18 Human)
ExpressionMammalianAvailable SinceNov. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
MSCV-AML1/ETO-IRES-GFP
Plasmid#60832PurposeAML1/ETO9a cDNA was generated by PCR from full-length human AML1/ETO-IRES-GFP and subcloned into MSCV-IRES-GFPDepositorAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FGFR1c-V5/HIS
Plasmid#201106Purposeexpression of human FGFR1 receptor tyrosine kinase in mammalian cellsDepositorInserthuman FGFR1 receptor tyrosine kinase, variant c, full length, wildtype (FGFR1 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only