We narrowed to 41,799 results for: LAT
-
Plasmid#190838PurposeFor mammalian expression of 3JB1F+12, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1F_T1+12bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1R
Plasmid#190839PurposeFor mammalian expression of 3JB1R, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1R (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1R+2
Plasmid#190840PurposeFor mammalian expression of 3JB1R+2, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1R_AP3+2bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pXD70Tet(DadRmt4)-DadR(linker)
Plasmid#191639PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), dadR(linker region shuffled) complementationDepositorInsertDadR
ExpressionBacterialMutationLinker region sequence shuffledAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadR-NFLAG)-N-3xFLAG-DadR
Plasmid#191640PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), N-3xFLAG-dadR complementationDepositorInsertDadR
Tags3xFLAGExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadRmt5)-N-3xFLAG-DadR(ΔDBD)
Plasmid#191641PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), N-3xFLAG-dadR(ΔDBD) complementationDepositorInsertDadR
Tags3xFLAGExpressionBacterialMutationΔDBDAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadRmt6)-N-3xFLAG-DadR(ΔTM)
Plasmid#191642PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), N-3xFLAG-dadR(ΔTM) complementationDepositorInsertDadR
Tags3xFLAGExpressionBacterialMutationΔTMAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadRmt7)-N-3xFLAG-DadR(linker)
Plasmid#191643PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), N-3xFLAG-dadR(linker region shuffled) complementationDepositorInsertDadR
Tags3xFLAGExpressionBacterialMutationLinker region sequence shuffledAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadH)-Pdadh-DadhABC(A2)
Plasmid#191644PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), native promoter-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strainDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBSKΔB-24xopto-TetO-no01
Plasmid#174887PurposePlasmid vector containing southern blot probe for opto-TetO in STREAMING-tagDepositorInsert24xopto-TetO
UseSouthern blot probeAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT002
Plasmid#182712PurposeaTc inducible dCasRx-IF1DepositorInsertdCasRx
UseCRISPRTags3x(GGGS)-Escherichia Coli Initiation Factor 1ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpTetAvailable SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
2Bc-T MBP_BoMoC(ed)_W403A_6xH
Plasmid#185712PurposeRecombinant B. mori truncated R2 RT expressionDepositorInsertB. mori truncated R2 RT
Tags6xHis and MBPExpressionBacterialMutationChanged W403 to APromoterT7Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-miRFP670-eDHFR(69K6)
Plasmid#178852PurposeMammalian expression of miRFP670-eDHFR(69K6)DepositorInsertmiRFP670-eDHFR(69K6)
UseLentiviralExpressionMammalianPromoterEF1-alphaAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-mNG-eDHFR(69K6)
Plasmid#178853PurposeMammalian expression of mNeonGreen-eDHFR(69K6)DepositorInsertmNeonGreen-eDHFR(69K6)
UseLentiviralExpressionMammalianPromoterEF1-alphaAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-eDHFR(69K6)-iRFP713
Plasmid#178855PurposeMammalian expression of eDHFR(69K6)-iRFP713DepositorInserteDHFR(69K6)-iRFP713
ExpressionMammalianPromoterCAGAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-miRFP670-eDHFR(69K6)
Plasmid#178859PurposeMammalian expression of miRFP670-eDHFR(69K6)DepositorInsertmiRFP670-eDHFR(69K6)
ExpressionMammalianPromoterCMVAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-Dm4E-T-L36AL39A_T
Plasmid#147604PurposeInsect Expression of Dm4E-T-L36AL39ADepositorInsertDm4E-T-L36AL39A (4E-T Fly)
ExpressionInsectMutationTwo non silent mutations (H628R and N659S) compar…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmCup-Y342AL347A_O
Plasmid#147103PurposeInsect Expression of DmCup-Y342AL347ADepositorAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-UTX(420-633)-H6
Plasmid#183773PurposeExpress pET-UTX(420-633)-H6 in E.coli. Purified pET-UTX(420-633)-H6 was used for generating antibodies in rabbits.DepositorInsertUTX
Tags6 His tag at the C-terminusExpressionBacterialPromoterT7Available SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-Dm4E-T_1-510-Y10AL15A-V5His6_D
Plasmid#146152PurposeInsect Expression of Dm4E-T_1-510-Y10AL15ADepositorInsertDm4E-T_1-510-Y10AL15A (4E-T Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPPC018.AAV
Plasmid#171146PurposeExpression of J1-BBa_J23117-mRFP and hAAVS1 scRNA on pRK2-GmR plasmidDepositorInsertshAAVS1 scRNA
J1-BBa_J23117-mRFP
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J1-BBa_J23117Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC030.306
Plasmid#171151PurposeMevalonate production pathway with J306 scRNA on pBBR1-GmR plasmidDepositorInsertsJ306 scRNA
J3-BBa_J23117-mvaES
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J3-BBa_J23117Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (E12,14A)-mVenus
Plasmid#168499PurposeMammalian expression of the E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K8,9R)-mVenus
Plasmid#168498PurposeMammalian expression of the K8,9R mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K8,9R mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN(K8,9A)-mPAGFP
Plasmid#168494PurposeMammalian expression of the K8,9A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertK8,9A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (E12,14K)-mVenus
Plasmid#168488PurposeMammalian expression of the E12,14K mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14K mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K8,9E)-mVenus
Plasmid#168487PurposeMammalian expression of the E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K22,24A)-mVenus
Plasmid#168484PurposeMammalian expression of the K22,24A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K22,24A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K8,9A)-mVenus
Plasmid#168483PurposeMammalian expression of the K8,9A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K8,9A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only