We narrowed to 7,668 results for: CCH
-
Plasmid#244683PurposeExpress mEGFP-tagged intrinsically disordered protein (IDR), FOidr_131, derived from human fusion protein PAX5_BZW1; PAX5_CBFA2T3; PAX5_ESRRA; PAX5_FOXP1; PAX5_JAK2; PAX5_KANK1; PAX5_NCOA5; PAX5_NOL4L; PAX5_PAX5; PAX5_ZCCHC7; PAX5_ZNF276; PAX5_ZNF521; ZCCHC7_PAX5DepositorInsertFOidr_131
Tagsmonomeric EGFPExpressionMammalianMutationUnmutatedAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc FLAG-kin-mec3-pRSFDuet
Plasmid#240741PurposeOver-express Sc FLAG-PKA kinase motif-mec3 in E. coliDepositorInsertFLAG-kin-mec3 (MEC3 Budding Yeast)
Tags3X FLAG followed by PKA kinase motifExpressionBacterialAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc hk/P-RFA3-pCDFDuet
Plasmid#240743PurposeOver-express his(10)-PKA kinase motif-PreScission protease site-Sc RFA3 in E. coliDepositorInserthk/P-RFA3 (RFA3 Budding Yeast)
TagsHis(10) followed by PKA kinase motif follwed by P…ExpressionBacterialAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc mec1-S6-P/FLAG-pRS403/GAL-L
Plasmid#240737PurposeOver-express Sc mec1-S6-PreScission Protease Site-FLAG in yeast (integrated)DepositorInsertmec1-S6-P/FLAG (MEC1 Budding Yeast)
TagsS6, followed by PreScission Protease site, follow…ExpressionYeastAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
PKA1317
Plasmid#239371PurposeS.cerevisiae Sla1-SH3#1-2 (5-131) W108A (mutation preventing binding to 2nd SH3)DepositorInsertSLA1 (5-131)
TagsGSTExpressionBacterialMutationW108AAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PKA1279
Plasmid#239375PurposeGST-Las17 (300-422) P388ADepositorInsertLas17 (amino acids 300-422)
TagsGSTExpressionBacterialMutationProline 388 to AlanineAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc [Pol31 + Pol32]-pRS403/GAL
Plasmid#239199PurposeOvererxpress Sc Pol31 & Pol32 when integrated into yeast (S. cer)DepositorAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAIP4_3D1B
Plasmid#234230PurposeHeterologous protein expression of RNA-induced transcriptional silencing complex protein tas3 in Escherichia coliDepositorAvailable SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAIP4_5EIP
Plasmid#234188PurposeHeterologous protein expression of RNA binding exosome specificity factor Mmi1 in Escherichia coliDepositorAvailable SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAIP4_3ONH
Plasmid#234179PurposeHeterologous protein expression of ubiquitin-activating enzyme E1-like in Escherichia coliDepositorAvailable SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only