We narrowed to 2,923 results for: COB;
-
Plasmid#205796PurposeExpress mEGFP-tagged fusion protein, CREBBP_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pENTR D-TOPO-C3_33
Plasmid#60275PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_COL3A1_CLU
Plasmid#205794PurposeExpress mEGFP-tagged fusion protein, COL3A1_CLU from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_AIMP2_EIF2AK1
Plasmid#205770PurposeExpress mEGFP-tagged fusion protein, AIMP2_EIF2AK1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_13
Plasmid#60298PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertEDN3 enhancer (EDN3 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CCDC6_ANK3
Plasmid#205788PurposeExpress mEGFP-tagged fusion protein, CCDC6_ANK3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_20
Plasmid#60303PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertCDKN1C enhancer (CDKN1C Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
KRAS-A146T
Plasmid#154426PurposeA146T Kras with Flag tag inserted into N-terminal domain between 6Xhis tag and TEV cleavage site.DepositorInsertKRAS (KRAS Human)
UseTags6xHis-tag and TEV protease cleavage sequenceExpressionBacterialMutationPromoterT5Available SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_15
Plasmid#60322PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS PHLDA1) (PHLDA1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_33
Plasmid#60312PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertGLIS3 enhancer (GLIS3 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_RUNX1_CBFA2T3
Plasmid#205914PurposeExpress mEGFP-tagged fusion protein, RUNX1_CBFA2T3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_KPNA1_GMPS
Plasmid#205844PurposeExpress mEGFP-tagged fusion protein, KPNA1_GMPS from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_LCLAT1_GREB10
Plasmid#205845PurposeExpress mEGFP-tagged fusion protein, LCLAT1_GREB1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_LMX1B_GTF3C5
Plasmid#205847PurposeExpress mEGFP-tagged fusion protein, LMX1B_GTF3C5 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MBNL1_MEIS2
Plasmid#205848PurposeExpress mEGFP-tagged fusion protein, MBNL1_MEIS2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MEX3D_DCTN6
Plasmid#205855PurposeExpress mEGFP-tagged fusion protein, MEX3D_DCTN6 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MFF_ERBB4
Plasmid#205856PurposeExpress mEGFP-tagged fusion protein, MFF_ERBB4 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_KMT2A_EPS15
Plasmid#205841PurposeExpress mEGFP-tagged fusion protein, KMT2A_EPS15 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ETV6_ABL1
Plasmid#205814PurposeExpress mEGFP-tagged fusion protein, ETV6_ABL1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only