We narrowed to 14,172 results for: cas9
-
Plasmid#110849PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-Puro
Plasmid#110850PurposeLentiviral vector for constitutive expression of Cas9-HF1 (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-PGK-Puro
Plasmid#110855PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-PGK-Puro
Plasmid#110856PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-GFP-PGK-Puro
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE_21 - pIVT_CMV-synUTR-inactT7-NLS-Cas9-NLS-XTEN-BLM(1-193)-NLS-HbaUTR
Plasmid#252017PurposeIn vitro transcription of Cas9-BLM(2-194) TruEditor for mRNA generationDepositorInsertCas9-BLM(2-194)
UseCRISPRExpressionMammalianMutationNAAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFZ1036
Plasmid#250676PurposeIPT along with RUBY for soybean genome editingDepositorInsertIPT, Cas9, RUBY
UseCRISPRExpressionPlantPromoterCaMV35, AtUbi10Available SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFZ1035
Plasmid#246938PurposeGmWUS along with RUBY for soybean genome editingDepositorInsertGmWUS, Cas9, RUBY
UseCRISPRExpressionPlantPromoterNOS, AtUbi10Available SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAGT6471
Plasmid#219428PurposeModule of intronized NLS-SpCas9-NLS for N-terminal and C-terminal tag fusions (AGGT_N-SpCas9i-N_TTCG)DepositorInsertAGGT_NLS-SpCas9i-NLS(no stop)_TTCG
UseMoclo compatible level 0 moduleAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV8-cPE-N
Plasmid#183538PurposeDeliver a split compact Prime Editor in vivoDepositorInsertN-terminal fragment of SpCas9 nickase (H840A)
UseAAVExpressionMammalianAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRGE31
Plasmid#50929PurposeExpressing sgRNA and Cas9 in plants. The sgRNA was controlled by rice snoRNA U3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRice snoRNA U3 and dual 35S promoterAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pICSL90016
Plasmid#117514PurposeCas9_2 Golden Gate Level 0DepositorInsertBsaI:AATG:Cas9_2:GCTT:BsaI
UseCRISPRTagsNLS_SV40ExpressionPlantAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6c-V106W
Plasmid#215826PurposeExpress CBE6c V106W (with SpCas9) in mammalian cellsDepositorInsertCBE6c V106W-SpCas9-2xUGI (cas9 )
UseIn vitro transcription templateAvailable SinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTK0_046
Plasmid#123976PurposeEncodes the Cas9 Thal5.10-2_hg18 homology destination with Hygromycin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemhDepositorInserthThal5.10-2_hg18 CAS9 Destination - HygroR
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova)
Plasmid#85041PurposeThis plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9.DepositorInsertloxP-stop-loxP
UseCRISPRExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCjedCas9
Plasmid#172216PurposeExpresses catalytically inactive Campylobacter jejuni Cas9 (CjedCas9) in bacterial cellsDepositorInsertcatalytic mutant of Cas9 endonuclease from the Campylobacter jejuni Type II CRISPR/Cas system
TagsHistagMutationchanged Asp 8 to Ala and His 559 to AlaAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only