We narrowed to 11,142 results for: hal
-
-
-
pHD57 [Tol2-UAS:sypb-egfp-cry2-polyA]
Plasmid#198381PurposeExpression of SYPB::CRY2olig(535) in neurons of Danio rerioDepositorInsertUAS:sypb-egfp-cry2
UseTol2TagsEGFPExpressionMutationD387APromoterUASAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
MuHKI-pGFPN3
Plasmid#21919DepositorInsertMutant huamn HKI (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK1 Human)
UseTagsGFPExpressionMammalianMutationThis is the full length human HKI cDNA sequence w…PromoterAvailable sinceNov. 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
sh-SRF
Plasmid#100797Purposeexpression of shRNA targeting SRFDepositorInsertrat SRF
UseRNAiTagsExpressionMutationPromoterH1Available sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATG-1929
Plasmid#108712PurposeCBR2opt in pF4Ag expression vector with T7 and CMV promoterDepositorInsertCBR2opt
UseTagsExpressionBacterial and MammalianMutationPromega used directed evolution to create CBR (Cl…PromoterT7, CMVAvailable sinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRESN2 H2B-GFP-uvr8at(2x)
Plasmid#44970DepositorUseTagsinternal GFPExpressionMammalianMutationtandem repeat of UVR8 (both have Methionine 1 del…PromoterpCMV IEAvailable sinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAB17 (punc-17::QuasAr)
Plasmid#214888PurposeExpresses the voltage sensor QuasAr2 in cholinergic neurons of C. elegans.DepositorInsertQuasAr2
UseTagsExpressionWormMutationPromoterAvailable sinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-SRRD-mRuby3
Plasmid#214920Purposeinducible expression of SRRD tagged on C-terminus with mRuby3DepositorInsertSRRD (SRRD Human)
UseLentiviralTagsmRuby3ExpressionMutationPromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only
