We narrowed to 581 results for: TRIP-1
-
Plasmid#192179PurposeClone 2 light chain (HK02)DepositorInsertClone 2 light chain (HK02)
ExpressionMammalianMutationNAAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
HH06-LP Clone 6 heavy chain
Plasmid#192176PurposeClone 6 heavy chain (HH06)DepositorInsertClone 6 heavy chain (HH06)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
HH13 Clone 13 heavy chain
Plasmid#192177PurposeClone 13 heavy chain (HH013)DepositorInsertClone 13 heavy chain (HH013)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
HH13A Clone 13A heavy chain
Plasmid#192178PurposeClone 13A heavy chain (HH13A)DepositorInsertClone 13A heavy chain (HH13A)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
HK13A Clone 13A light chain
Plasmid#192182PurposeClone 13A light chain (HK13A)DepositorInsertClone 13A light chain (HK13A)
ExpressionMammalianMutationNAAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:(MCS)-S11-DI-GFP1–9
Plasmid#108260PurposeBinary vectors used for the inducible expression of dual intein-coupled tripartite split-sfGFP components in plantsDepositorTypeEmpty backboneUseSynthetic BiologyExpressionPlantPromoterUBQ10:sXVE:Available SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGreenII Tfs-qqr::LUC
Plasmid#44466PurposeExpresses a luciferase gene disrupted by a QQR ZFN target site and a frame-shift mutationDepositorInsertA luciferase gene disrupted by a QQR ZFN target site and a frame-shift mutation
UseLuciferase; Plant transformationMutationA disruption was made between the first and secon…Promoter35S PromoterAvailable SinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
KSP_K560GFP
Plasmid#129770PurposeExpresses Xenopus Kinesin-5 KSP head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertKSP (kif11.L Frog)
TagsGFP and His6ExpressionBacterialMutationTruncation at 367, fused to kinesin-1 starting Al…Available SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-TVAmCherry-2A-G(N2c)
Plasmid#194354PurposeAAV expressing TVA-mCherry fusion and Rabies Glycoprotein (G) of CVS-N2c strain under neuronal-specific promoterDepositorInsertsTVA-mCherry fusion protein
Rabies CVS-N2c Glycoprotein
UseAAVAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-H2B-3xFLAG-2A-G(N2c)
Plasmid#194355PurposeAAV constitutively expressing nuclear FLAG and Rabies Glycoprotein (G) of CVS-N2c strainDepositorInsertsH2B-3xFLAG
Rabies CVS-N2c glycoprotein (G)
UseAAVTagsFLAGAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-2A-G(N2c)-WPRE
Plasmid#194352PurposeLentivirus expressing eGFP and Rabies Glycoprotein (G) from CVS-N2c strainDepositorInsertsEnhanced Green Fluorescent Protein (eGFP)
Rabies CVS-N2c glycoprotein (G)
UseLentiviralAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:ATG-3xHA-S11
Plasmid#108238PurposeBinary vectors used for the inducible expression of tripartite split-sfGFP components (3xHA-S11 as control) in plantsDepositorInsertATG-3xHA-S11
UseSynthetic BiologyExpressionPlantPromoterUBQ10:sXVE:Available SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGreenII Tfs-494::LUC
Plasmid#44467PurposeExpresses a luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutationDepositorInsertA luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutation
UseLuciferase; Plant transformationMutationA disruption was made between the first and secon…Promoter35S PromoterAvailable SinceApril 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
Clone 16 - 2 HH06 pFUSE-IgG1-Knob-mutation knob-clone6
Plasmid#192184PurposeClone 16 (HH06) pFUSE-IgG1-Knob-mutation knob-clone6DepositorInsertClone 6 heavy chain (HH06)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-μ1A-(HA)3
Plasmid#198177PurposeExpression of HA-tagged AP-1 μ1A in mammalian cellsDepositorInsertAP-1 μ1A
Tagstriple HA tagExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-CAG-GFP-EnvA(N2c)
Plasmid#194353PurposeLentivirus expressing eGFP and (EnvA-N2c Rabies Glycoprotein) fusion protein. Used to package EnvA pseudotyped G-deleted Rabies of CVS-N2c strainDepositorInsertsEnhanced Green Fluorescent Protein (eGFP)
EnvA-CVS-N2c Rabies Glycoprotein
UseLentiviralAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Clone 16 - 3 HK02 pFUSE-IgG-human kappa VL-CH1 hole-clone2
Plasmid#192185PurposeClone 16 (HK02) pFUSE-IgG-human kappa VL-CH1 hole-clone2DepositorInsertClone 2 light chain (HK02)
ExpressionMammalianMutationNAAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Ub-Myc-LgBiT
Plasmid#241817PurposeExpresses Myc-tagged and LgBiT-tagged Ubiquitin for use with the Promega HiBiT systemDepositorInsertUbiquitin
TagsLgBiT and MycExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRP-B-catenin-V5-LgBiT
Plasmid#241816PurposeExpresses V5-tagged and LgBiT-tagged B-catenin for use with the Promega HiBiT systemDepositorInsertB-catenin
TagsLgBiT and V5ExpressionMammalianAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-MPP8-10xHis
Plasmid#194178PurposeExpresses MPP8-10xHis taggedDepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-MPP8-W80A-10xHis
Plasmid#194179PurposeExpresses MPP8-W80A_10xHisDepositorInsertMPHOSPH8 (MPHOSPH8 Human)
Tags10xHisExpressionMammalianMutationMPP8-W80A inside chromo domainPromoterCMVAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-MPP8-delta2-441-10xHis
Plasmid#194181PurposeExpresses MPP8-delta2-441_10xHisDepositorInsertMPHOSPH8 (MPHOSPH8 Human)
Tags10xHisExpressionMammalianMutationMPP8-delta2-441PromoterCMVAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-MPP8-delta442-860-10xHis
Plasmid#194182PurposeExpresses MPP8-delta442-860_10xHisDepositorInsertMPHOSPH8 (MPHOSPH8 Human)
Tags10xHisExpressionMammalianMutationMPP8-delta442-860PromoterCMVAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-MPP8-delta600-728-10xHis
Plasmid#194183PurposeExpresses MPP8-delta600-728_10xHisDepositorInsertMPHOSPH8 (MPHOSPH8 Human)
Tags10xHisExpressionMammalianMutationMPP8-delta600-728 (4xANK deletion)PromoterCMVAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:GFP1–10
Plasmid#125663PurposeBinary vector for the inducible expression of GFP1–10 fragment that can be used to detect a protein tagged with GFP11DepositorInsertGFP1–10
UseSynthetic BiologyExpressionPlantPromoterUBQ10:sXVE:Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:S11-GFP1–9
Plasmid#125665PurposeBinary vector for the inducible expression of S11-GFP1–9 fragment that can be used to detect a protein tagged with GFP10DepositorInsertS11-GFP1–9
UseSynthetic BiologyExpressionPlantPromoterUBQ10:sXVE:Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLoxP-EGFP-crRNA-entry
Plasmid#213048PurposeSWITCHER ready LoxP-EGFP reporter plasmid for cloning of a customized CRISPR-inducible Cre-constructDepositorInsertLoxP-EGFP-MALAT1-triplex
UseCRISPRExpressionMammalianAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-MPP8-delta55-118-10xHis
Plasmid#194180PurposeExpresses MPP8-delta55-118_10xHisDepositorInsertMPHOSPH8 (MPHOSPH8 Human)
Tags10xHisExpressionMammalianMutationMPP8-delta55-118 (chromo domain deletion)PromoterCMVAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:ER-GFP1–10
Plasmid#125664PurposeBinary vector for the inducible expression of ER-targeted GFP1–10 fragment that can be used to detect a protein tagged with GFP11DepositorInsertER-GFP1–10
UseSynthetic BiologyExpressionPlantPromoterUBQ10:sXVE:Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pResQ shFEN3 3XF-FEN1 wt
Plasmid#17752DepositorInsertFlap Endonuclease I (FEN1 Human)
UseLentiviral and RNAiTagsTriple FlagExpressionMammalianAvailable SinceApril 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
C234-E08: attB2r-3xFLAG-attB3
Plasmid#162912PurposeGateway attB2r/attB3 entry clone for construction of C-terminal triple-FLAG epitope tagged fusion proteinsDepositorInserttriple FLAG epitope tag
UseSynthetic BiologyAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:ER-S11-GFP1–9
Plasmid#125666PurposeBinary vector for the inducible expression of ER-targeted GFP1–9 fragment that can be used to detect a protein tagged with GFP10DepositorInsertER-S11-GFP1–9
UseSynthetic BiologyExpressionPlantPromoterUBQ10:sXVE:Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRP-BRG1-HA-SmBiT
Plasmid#241815PurposeExpresses HA-tagged and HiBiT-tagged BRG1 for use with the Promega HiBiT systemDepositorAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pResQ shFEN3 3XF-FEN1 D181A
Plasmid#17753DepositorInsertFlap Endonuclease I (FEN1 Human)
UseLentiviral and RNAiTagsTriple FlagExpressionMammalianMutationD181AAvailable SinceApril 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pKS_3HA_PAC
Plasmid#122564PurposeVector for endogenously tagging Giardia genes with a triple HA tag (Puromycin selection)DepositorTypeEmpty backboneTagshemagglutinin tagAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKS_3HA_BSR
Plasmid#122567PurposeVector for endogenously tagging Giardia genes with a triple HA tag (Blasticidin selection)DepositorTypeEmpty backboneTags3x hemagglutinin tagAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only