We narrowed to 6,200 results for: cas9 expression plasmid
-
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-Blast
Plasmid#159741PurposeExpresses Cas9-2A-Blast and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorInsertdonor plasmid targeting sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-mCherry
Plasmid#159742PurposeExpresses Cas9-2A-mCherry and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorInsertdonor plasmid targeting sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-G6
Plasmid#73437PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant G6.DepositorInsertRepressor G6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-C4
Plasmid#73427PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cas9_ANKRD1_sgRNA2
Plasmid#186669PurposePlasmid containing Cas9 and ANKRD1 sgRNA2 , sgRNA sequence: cggtcagcttatatagct.DepositorInsertANKRD1 KO sgRNA Plasmid (ANKRD1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-dCas9-KRAB-MeCP2_Hygro
Plasmid#192664Purpose3rd generation lenti vector encoding dCas9-KRAB-MeCP2 with 2A Hygro resistance markerDepositorInsertdCas9-KRAB-MeCP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A, D839A, H840A and N863A in Cas9PromoterEF1aAvailable sinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-dCas9-VPR-wpA-pPuroTK
Plasmid#214127PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInsertdCas9-VPR
UseCRISPRTagsExpressionMammalianMutationCodon-optimized for mammalian cellsPromoterAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJUMP29[dCas9]-1A(lacZ)
Plasmid#126979PurposeLevel 1 vector. With lacZ as alternative cloning reporter.OriV 9 (pBBR322/ROP; medium copy number). Constitutive dCas9 in downstream secondary site.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationCas9 catalytically deadPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-EFS-HypaSpCas9-P2A-puro
Plasmid#106965Purposesingle-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screenDepositorInsertHypaSpCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFSAvailable sinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-EFS-HypaSpCas9-P2A-EGFP
Plasmid#106964Purposesingle-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screenDepositorInsertHypaSpCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFSAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV-dCas9_puroR
Plasmid#219825PurposeCMV-driven expression of dCas9 with puromycin resistance (Adapted from plasmid #68416)DepositorInsertdCas9
UseCRISPRTagsExpressionMammalianMutationD10A/H841APromoterCMVAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459)
Plasmid#48139PurposeNOTE: A new version of this plasmid is now available. See Addgene plasmid 62988.DepositorInserthSpCas9-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCbhAvailable sinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-dCas9-VP64-MS2-VP64-ZsG
Plasmid#192669PurposeDox-inducible expression of dCas9-VP64 with P2A MS2-VP64 and T2A ZsGreen1DepositorInsertdCas9-VP64, MS2-VP64, ZsGreen1
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A and N863A in Cas9PromoterTRE3GAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiV2-dCas9-VP64
Plasmid#141104PurposeExpression of gRNA and dCas9-VP64 from the same plasmid for CRISPRaDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only