We narrowed to 2,348 results for: 1186
-
Plasmid#1186DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pPICZ-pre-pro-alphaf(I)-E2-Crimson
Plasmid#117660PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-pro-alphaf(I)-E2-Crimson
ExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSH-CAG-AtAFB2.F74A-IRES-puro
Plasmid#216245PurposeExpress AtAFB2.F74A mutant without tag for AID2DepositorInsertAtAFB2.F74A
UseCRISPR and TALEN; Human safe harbor locus (a avs1…ExpressionMammalianMutationF74A mutationPromoterCAGAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
SaCas9v3-Puro
Plasmid#178813PurposeSaCas9 with 2A-Puro, and a cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V3
Plasmid#226956PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Pdg459-eSp(1.1) V3
Plasmid#226965PurposeCBh-eSpCas9(1.1)-2A-Puro, and 2X hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF
Plasmid#74924PurposeMammalian expression of human NSF full-length (744 aa)DepositorAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hOCT3/4-shp53-F + mCherry-2A-puro
Plasmid#74947PurposeDosage control and tracing of reprogramming episomesDepositorInsertOct3/4 (POU5F1 Human)
ExpressionMammalianAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMYH9-D1424H-FLAG
Plasmid#183513PurposeGateway expression vector encoding D1424H mutant MYH9 cDNA, with N-terminal Flag tag. For mammalian expression.DepositorInsertMYH9 (MYH9 Human)
TagsFLAGExpressionMammalianMutationchanged Aspartic acid 1424 to HistidinePromoterCMVAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458 eSp(1.1) V3
Plasmid#226963PurposeCBh-eSpCas9(1.1)-2A-GFP, and hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-GFP-LoxP-SNAP-TERT
Plasmid#71391PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes GFP marker flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:BRD:tNos (GB1172)
Plasmid#75401PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the BRD Transcriptional RepressorDepositorInsertdCas9:BRD
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET21a-C2m2-SNAP
Plasmid#208773PurposeTo express C2m2-SNAP in bacteriaDepositorInsertC2m2-SNAP (Mfge8 Mouse)
TagsSNAP-tagExpressionBacterialMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterT7 promoterAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSH-EF1a-OsTIR1.F74A-mCherry-IRES-puro
Plasmid#216247PurposeExpress OsTIR1.F74A mutant with mCherry tag for AID2DepositorInsertOsTIR1.F74A
UseCRISPR and TALEN; Human safe harbor locus (a avs1…TagsmCherryExpressionMammalianPromoterEF1aAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICSL11060
Plasmid#68264PurposeLevel 1 Golden Gate Cassette: Cas9 expression cassette for plants (exemplified in Brassica oleracea)DepositorInsertPromoter/5UTR: CsVMV+ CDS:SpCas9 + 3UTR/terminator:35s
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET21a-C2m2-mKate
Plasmid#208765PurposeTo express C2m2-mKate in bacteriaDepositorInsertC2m2-mKate (Mfge8 Mouse)
TagsmKateExpressionBacterialMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterT7 promoterAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSYC-176
Plasmid#178961PurposeExpresses human GFAP fused to 3xFLAG tag in mammalian cellsDepositorInsertGlial fibrillary acidic protein (GFAP Human)
Tags3xFLAGExpressionMammalianPromoterCMV IE94 PromoterAvailable SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
PCXLE-hUL + mTAGBFP2
Plasmid#74944PurposeDosage control and tracing of reprogramming episomesDepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
HR-TERT-SV40-GFP
Plasmid#71397PurposeHomologues recombination donor plasmid fo the TERT promotor region introducing a SV-40 driven GFP marker in the TERT promotor. Includes 1kb of TERT coding region in right homologues arm.DepositorInsertTERT (TERT Human)
TagsSV-40 GFP insertion in TERT promotorPromoterEndogenous TERT promotorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only