We narrowed to 3,202 results for: Streptococcus
-
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pL40C_PGKintron_Cas9_Green
Plasmid#134966PurposeLentiviral vector coding Cas9 and mNeonGreenDepositorInsertCas9-P2A-mNeonGreen
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterhPGK promoter with beta-globin intronAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
hAID-BE3 (pRZ352)
Plasmid#131316PurposeCAG promoter expression plasmid for hAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL680 CHYRON3 integration construct
Plasmid#126448PurposeTo integrate the CHYRON3 locus at AAVS1 in human cells.DepositorInsertspU6/3xLacO-CHYRON3 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6/3xLacOAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2XNLS-SpCas9WT-NLS-3XHA-2XNLS-NmdCas9-NLS
Plasmid#107327PurposeExpresses SpCas9 fused to dNmCas9 in mammalian cellsDepositorInsertSpCas9-NmCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 is fused to nuclease dead NmCas9 (D16A, D5…PromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E6MBW6
Plasmid#103102PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE6MBW6(Cas9 coding gene from Staphylococcus lugdunensis M23590)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
ciCas9(L22)_pcDNA5
Plasmid#100551PurposeExpresses ciCas9(L22) in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables.DepositorInsertciCas9(L22)
UseCRISPR; Frt, flp-inTagsFLAGExpressionMammalianAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-VQR-GFP_activity_reporter
Plasmid#87156PurposeThis lentiviral vector can be used to assay activity of SpCas9-VQR (NGA PAM restricted).DepositorInsertGFP and sgRNA targeting GFP (NGA restricted)
UseLentiviralAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAct:dCas9-scFv
Plasmid#78900PurposeExpresses scFv-VP64 under actin promoter for SunTag CRISPRa in Drosophila cellsDepositorInsertscFV-VP64
UseCRISPRTagsGFPExpressionInsectPromoterpActin (Drosophila)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICSL80036
Plasmid#68259PurposeLevel 0 Golden Gate Part: Coding sequence, hygromycin phophotransferase II (Escherichia coli)DepositorInsertCoding sequence, hygromycin phophotransferase II (Escherichia coli)
UseSynthetic BiologyAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pvPE-V4-Puro
Plasmid#240290PurposeEncodes fourth generation porcine endogenous retrovirus-derived prime editing (pvPE) system with puromycin resistance gene into mammalian cells for gene editing.DepositorInsertpvPE-V4-Puro
UseCRISPRTagsSV40 NLS and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS9_10xHis_MBP_TEV_dCas9
Plasmid#244831PurposeBacterial expression of catalytically inactive Cas9 (dCas9) for protein purificationDepositorInsertdCas9 (WT)
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD10A/H840APromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAGT9054
Plasmid#219430PurposeTranscriptional unit (MoClo-position 2): 2x35Ss_Omega enhancer_PapE-4LF2-N-SpCas9i-N_tOCSDepositorInsertLB_2x35Ss-omega enhancer:PapE-4xLF2-NLS-SpCas9i-NLS:tOCS_RB (Position 2)
UseCRISPR; Moclo compatible level 1 module (position…TagsPapE-4LF2ExpressionPlantAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-nSpCas9-APOBEC3A
Plasmid#209040PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized cytosine base editor where APOBEC3A is fused to the N-terminus of SpCas9(D10A)-sDNA Rad51-2xUGI-6xNLSDepositorInsertAPOBEC3A-nSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPEmax-Hygro
Plasmid#214020Purposeinducible PEmax system for controllable prime editing; this plasmid is used to insert PEmax prime editor in one allele of AAVS1 locusDepositorInsertPEmax
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG-Hypa
Plasmid#218165PurposeThis plasmid harbors the base editor eSCBE3-NG-Hypa along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity cytosine base editing at targets bearing NG PAM in StreptomycesDepositorInsertsescbe3-NG-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SlugABE-NNG-P2A-puro
Plasmid#214354PurposeExpresses SlugABE-NNG and puromycin resistance genesDepositorInsertSlugABE-NNG and puromycin resistance genes
ExpressionMammalianMutationQ782R/S888R/L906R/N984S/E1012K/K1016IAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBT/EFS-Cas9-PuroTk
Plasmid#170542PurposeExpresses spCas9 with a P2A junction to the puromycin resistance gene directly fused to the thymidine kinaseDepositorInsertPuroTK
UseCRISPRExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’-LMNA-eGFP-KI
Plasmid#170545PurposeExpresses a sgRNA for 5' tagging to LMNA and contains a cassette with eGFP flanked by homology arms for LMNADepositorInsertsLeft Homology arm for LMNA knockin
Right Homology arm for VIM knockin
UseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
EC67844
Plasmid#209514PurposeCloning in complete guide expression cassettes, with Cas9DepositorTypeEmpty backboneUseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only