We narrowed to 30,923 results for: ide
-
Plasmid#167121PurposePlant binary expression vector containing the coding sequence of the Arabidopsis Copia93 retroelement EVADE (AT5G17125) with U1 binding site mutated under CaMV 35S promoter.DepositorInsertEVADE (EVD) (AT5G17125 Mustard Weed)
ExpressionPlantMutationmutated four nucleotides at the snoRNA U1 binding…PromoterCaMV 35SAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#1)
Plasmid#166240PurposesgRNA (#1) to generate a knockout of human CRBN by targeting the middle region of Exon1DepositorAvailable SinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#2)
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorAvailable SinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pInducer-FRA1
Plasmid#192267PurposeDoxycycline-inducible expression of murine FRA1 (Fosl1)DepositorAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FRA1
Plasmid#188665PurposeExpresses murine FRA1 (Fosl1)DepositorAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.1
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*leu*
Plasmid#21173DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…Available SinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pHBT-HRAS174
Plasmid#248049PurposeTo express His6 tag-Avi tag-TEV cleavage site-HRAS (residues 1-174) in E. coli, under the T7 promoter.DepositorInsertHRAS (HRAS Human)
TagsHis6 tag-Avi tag-TEV cleavage site N-terminal to …ExpressionBacterialMutationincludes aa 1-174 onlyPromoterT7Available SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHBT-NRAS174
Plasmid#248051PurposeTo express His6 tag-Avi tag-TEV cleavage site-NRAS (residues 1-174) in E. coli, under the T7 promoter.DepositorInsertNRAS (NRAS Human)
TagsHis6 tag-Avi tag-TEV cleavage siteExpressionBacterialMutationincludes aa 1-174 onlyPromoterT7Available SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
Neo-2/15-TGFa-SPMn-SpyTag003
Plasmid#246650PurposeExpresses Neo-2/15-TGFa-SPMn-SpyTag003 in mammalian cells for calcium-induced NeissLock protein ligation to epidermal growth factor receptor (EGFR)DepositorInsertNeo-2/15-TGFa-SPMn-SpyTag003
TagsSignal peptide and SpyTag003ExpressionMammalianMutationConstruct contains the tPA signal peptide, Neo2/…PromoterCMV promoterAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_S5E2_Chrimson_tdTomato
Plasmid#219432PurposeAAV construct expressing Chrimson-tdTomato under the control of E2 regulatory elementDepositorInsertChrimson-tdTomato
UseAAVAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDF_AtRaf1/Raf2/RbcX2/BSD2/RbcX1
Plasmid#229510PurposeExpresses Arabidopsis thaliana chaperones: Raf1,Raf2,RbcX2,BSD2,RbcX1DepositorInsertsExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX_305-N-dTAG-FRA1
Plasmid#188742Purposeexpresses murine Fosl1 (Fra1) with N-terminal tag FKBP F36V (dTAG) for the dTAG systemDepositorInsertFosl1 (Fosl1 Mouse)
UseLentiviralTagsFKBP F36V tag (dTAG)ExpressionMammalianPromoterhPGK promoterAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7vB4
Plasmid#113073PurposePlasmid for highly efficient expression of engineered IL24 with binding affinity to cognate receptorsDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 SUMO part (Brachypodium distachyon), Human)
TagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7
Plasmid#113072PurposePlasmid for highly efficient expression of engineered IL24 with mutated binding sitesDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 SUMO part (Brachypodium distachyon), Human)
TagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBT-KRAS174
Plasmid#248050PurposeTo express His6 tag-Avi tag-TEV cleavage site-KRAS (residues 1-174) in E. coli, under the T7 promoter.DepositorInsertKRAS (KRAS Human)
TagsHis6 tag-Avi tag-TEV cleavage siteExpressionBacterialMutationincludes aa 1-174 onlyPromoterT7Available SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-dTom-nlsdTom
Plasmid#135630PurposeAAV vector to drive the expression of dTomato in PV cortical interneurons under the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only