We narrowed to 20,426 results for: REN
-
-
P-rTetO-mCherry-T2A-RPL22-1xV5
Plasmid#170325PurposeTetracycline-inducible expression of V5 and mCherry tagged RPL22DepositorAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-20XUAS-IVS-Syn21-jGCaMP8m-p10
Plasmid#162387PurposeGal4 activated transgene expression of ultrafast protein calcium sensor under the hsp70 promoter in D. melanogasterDepositorInsertjGCaMP8m
Tags6xHisExpressionInsectMutationA25G F286YPromoterhsp70Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF0275
Plasmid#142582PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNAI-GAL4-CREB
Plasmid#46769PurposeExpression of GAL4 fusion to wild type CREBDepositorTagsGAL4ExpressionMammalianPromoterCMVAvailable SinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Puro-IKBalpha-wt
Plasmid#15290DepositorAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
TFORF0930
Plasmid#143242PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCardinal-Vimentin-7
Plasmid#56178PurposeLocalization: Intermediate Filaments, Excitation: 604, Emission: 659DepositorAvailable SinceFeb. 27, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
Nxph4-2A-CreERT2 Targeting Vector
Plasmid#62219PurposeTargets CreERT2 to the mouse Nxph4 stop codonDepositorInsertNxph4-2A-CreERT2 (Nxph4 Mouse, Bacteriophage)
UseCre/Lox and Mouse TargetingExpressionMammalianPromoterMouse Nxph4Available SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only
