We narrowed to 7,210 results for: aav
-
Plasmid#100276PurposeAAV-CRISPR library for pool mutagenesis of top tumor suppressor genesDepositorUseAAV, CRISPR, Mouse Targeting, and Synthetic Biolo…ExpressionMammalianAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tbg-CES2A-ΔC-S227A
Plasmid#200560PurposeSecreted mouse CES2A S227A mutant driven by heptaocyte-specific promoter in AAV viral vectorDepositorInsertMouse Carboxylesterase 2A S227A mutant delta C-terminal (Ces2a Mouse)
UseAAVTagsFlagPromoterCMV promoterAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAav-MCS-PQS2-3xHA
Plasmid#84917PurposerAAV-based template for genome engineering of protein C-termini containing PQS2 and 3xHA tags and a selection cassetteDepositorInsertLOX-PGK-NEO-LOX
UseAAVTagsPQS2 3xHAPromotermPGKAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOttc1495 - pAAV CaMKII SERCaMP_ASARTDL
Plasmid#192602PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.DepositorInsertSERCaMP
UseAAVPromoterCaMKIIAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2_hSyn_NES-Caprola_04-mEGFP_WRPE-SV40
Plasmid#194688PurposehSyn1 driven expression of the calcium recorder Caprola_04 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_04-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-tdTomato
Plasmid#122099PurposeAAV-mediated expression of Chronos-tdTomato under the EF1α promoter (1.1kb short version). tdTomato has codons varied to reduce recombination. Using SV40 pA signal.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAav-TP53-T2A-BirA*
Plasmid#115652PurposerAAV-based donor template for genome engineering of the TP53 protein C-terminus containing a T2A-BirA* module and a selection cassetteDepositorUseAAVTagsBirA* and T2AMutationHomology region 1 and Homology region 2Available SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-eGFP-RAB11
Plasmid#203731PurposeAAV vector plasmid expressing human RAB11 fused to eGFP under the human synapsin (SYN) promoterDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV asyn S87A/S129A
Plasmid#36070DepositorInsertalpha-synuclein S87A/S129A (SNCA Human)
UseAAVExpressionMammalianMutationS87A/S129APromoterCMVAvailable SinceSept. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DIO-GRAB_CRF1.0
Plasmid#208662PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0 in a cre-dependent mannerDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0
UseAAVPromoterEFSAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-CsChR-GFP
Plasmid#58841PurposeAAV expression of CsChR-GFP under the Syn promoterDepositorInsertCsChR-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEO-CaMKII-EGFP
Plasmid#177018PurposeFor expression of EGFP in a single-floxed, excisable open reading frame (cre-off), under control of the CaMKIIa promoterDepositorInsertEGFP
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianPromoterCaMKIIaAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV Gsk3 sgRNA/GFP
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-PDGFRb559-562del-HA
Plasmid#204351PurposeExpresses a mutant PDGFRb gene (559-562 deletion). Used for DNA delivery using Adeno-associated Virus.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
UseAAVTagsHAMutation559-562 deletionAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-alphaCaMKII-E2-Crimson-3XNLS-pA
Plasmid#183803PurposeAAV vector to express nuclear localized E2-Crimson from CaMKIIa promoterDepositorInsertE2-Crimson-NLS
UseAAVTagsNLSAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc CB6PI Gpluc7XmiR-122T
Plasmid#35647DepositorInsert7 bulged miR-122 target sites
UseAAVPromoterCBAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synp-F-H2B-GCaMP6f
Plasmid#102994PurposeExpresses histone fused GCaMP6f under the synapsin promoterDepositorInsertH2B-GCaMP6f
UseAAVExpressionMammalianPromoterhuman synapsin I promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only