We narrowed to 4,786 results for: Mos
-
Plasmid#229023PurposeExpression of a EnAsCas12a control guide that cuts an intergenic region on chromosome 2DepositorInsertsgChr2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_051d_sgCiChr2-2
Plasmid#228940PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertsgChr2-2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIOS1458
Plasmid#171715Purposeexpresses maize Glutamine Synthetase ZmGln1-3 cDNA under the control of the Cassava Vein Mosaic Virus promoter (CsVMV) (cassette 1) and the maize Rubisco small subunit promoter (ZmRbcS) (cassette 2)DepositorInsertZmGln1-3
UseTagsExpressionPlantMutationPromoterAvailable sinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNMSB96
Plasmid#199316PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR
UseTagsExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD438
Plasmid#168464PurposeFor the insertion pf NLS-mEos3.2-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mEos3.2-NLS
UseTagsExpressionMammalianMutationPromoterCMV promoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_nocharge_wR
Plasmid#139119Purposeexpress hnRNPA2 LC with no charged residues with R added backDepositorInserthnRNPA2 (HNRNPA2B1 Human)
UseTagsExpressionBacterialMutationremove all K, most DPromoterAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP3
Plasmid#129506PurposeExpresses AvicFP3 constitutively in E. coli (most strains)DepositorInsertAvicFP3
UseTagsExpressionBacterialMutationPromotersynthetic constitutive (stationary phase) promote…Available sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R47A)
Plasmid#112722PurposeArg47 within TBP6.7 is the most critical residue in terms of forming interactions with WT TAR. Mutating this amino acid to Ala results in ~600-fold reduction in Kd.DepositorInsert6His-TEV-TBP6.7(R47A)
UseTags6His-TEVExpressionBacterialMutationR47APromoterT7Available sinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_EB
Plasmid#66013PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [E:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_FB
Plasmid#66014PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [F:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_GB
Plasmid#66015PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [G:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- R5A-K5A N23 C11orf83-GFP
Plasmid#65846PurposeMammalian expression of the mutated N terminal part (R5A-K5A N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorInsertTransmembrane (23 AA) of UQCC3 (UQCC3 Human)
UseTagsGFPExpressionMammalianMutationR5A-K6APromoterAvailable sinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- R5D-K6D N23 C11orf83-GFP
Plasmid#65847PurposeMammalian expression of the mutated N terminal part (R5D-K5D N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorInsertTransmembrane (23 AA) of UQCC3 (UQCC3 Human)
UseTagsGFPExpressionMammalianMutationR5D-K6DPromoterAvailable sinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Magoh198delG
Plasmid#30481DepositorInsertMagoh (Magoh Mouse)
UseTagsExpressionMammalianMutation198delG (point nucleotide deletion)PromoterAvailable sinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGD-p19
Plasmid#196326Purpose35S promoter-driven expression of the tomato bushy stunt virus p19 RNA silencing suppressorDepositorInserttomato bushy stunt virus p19
UseTagsExpressionPlantMutationPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCK306
Plasmid#110544PurposerhaBAD, a rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteria.DepositorInsertsPrhaBAD
yfp
rhaS
UseTagsExpressionBacterialMutationPromoterN/A, PrhaBAD, and kanR promoter (upstream of kanR…Available sinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGD-P1/HC-Pro
Plasmid#196328Purpose35S promoter-driven expression of the tobacco etch virus P1/HC-Pro RNA silencing suppressorDepositorInserttobacco etch virus P1/HC-Pro
UseTagsExpressionPlantMutationPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB84
Plasmid#199309PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR
UseTagsExpressionWormMutationmTagBFP2 from pJJR81, ChR2(H134R;D156C), C. elega…Promoterflp-18Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNMSB104
Plasmid#199314PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR
UseTagsExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v2
Plasmid#195139Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v1
Plasmid#195138Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-linker-TlcnC
Plasmid#114377Purposeexpresses Flpo recombinase-dependent GtACR2-Kv2.1C-linker-TlcnC, which targets GtACR2 to the somatodendritic compartment. Messier et al found this hybrid construct was the most effective at targetingDepositorInsertGtACR2-EYFP-Kv2.1C-linker-TlcnC (NEWENTRY )
UseAAVTagsEYFP and Kv2.1C-linker-TlcnCExpressionMammalianMutationPromoterEf1aAvailable sinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTD79
Plasmid#172900PurposeNeuronal promoter rgef-1P::TIR1::F2A::TagBFP2::AID* with homology arms for insertion in ttTi4348 site on chromosome IDepositorInsertTIR-1 (TIR1 Mustard Weed)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTD80
Plasmid#172901PurposeIntestinal promoter ges-1P::TIR1::F2A::TagBFP2::AID* with homology arms for insertion in ttTi5605 site on chromosome IIDepositorInsertTIR-1 (TIR1 Mustard Weed)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNMSB99
Plasmid#199308PurposeMosSCI insertion of myo-3p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertmyo-3p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR
UseTagsExpressionWormMutationmTagBFP2 from pJJR81, ChR2(H134R;D156C), C. elega…Promotermyo-3Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH728-CEN-RLuc/maxCFLuc
Plasmid#38212DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP4
Plasmid#129507PurposeExpresses AvicFP4 constitutively in E. coli (most strains)DepositorInsertAvicFP4
UseTagsExpressionBacterialMutationOne of two variants of AvicFP4 tested with essent…Promotersynthetic constitutive (stationary phase) promote…Available sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS511b
Plasmid#87387PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-FRT-TO-SSPB(micro)-mVenus-GCN4-ppKin14VIb(861-1321)_P2A_iLID-mCherry-RAB11
Plasmid#174647PurposeOptogenetic coupling of RAB11 to tetramerized moss kinesin-14 to induce retrograde transport of recycling endosomes. Compatible with Flp-in TREX system.DepositorInsertSSPB(micro)-mVenus-GCN4-ppKin14Vib(816-1321)-P2A-iLID-mCherry-RAB11
UseTagsExpressionMammalianMutationSSPB:Arg73Gln; mVenus: Met1Del, Thr154Met; ppKin1…PromoterCMV (with TetOn)Available sinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only