We narrowed to 1,496 results for: asl;

#136464

Mammalian expression of F-actin targeted ultrasensitive hydrogen peroxide indicator HyPer7 fused with LifeAct peptide for optical imaging

Vsevolod Belousov

Pak et al Cell Metab. 2020 Mar 3;31(3):642-653.e6.

Feb. 11, 2020

Academic Institutions and Nonprofits only

#107425

Mammalian expression of human alpha synuclein

Hilal Lashuel

Mbefo et al J Biol Chem. 2015 Apr 10;290(15):9412-27

March 29, 2018

Academic Institutions and Nonprofits only

#105728

Bacterial expression of mutant human alpha synuclein

Hilal Lashuel

Mbefo et al J Biol Chem. 2015 Apr 10;290(15):9412-27

April 2, 2018

Academic Institutions and Nonprofits only

#239626

Rhamnose inducible expression plasmid for anti-mouse nanobody fusion to Hia5 DNA adenine methyltransferase

Aaron Straight

Gamarra et al bioRxiv [Preprint]. 2025 Mar 14:2025.03.

July 7, 2025

Academic Institutions and Nonprofits only

#141071

Bacterial expression of ultrasensitive hydrogen peroxide indicator HyPer7 for optical imaging

Vsevolod Belousov

Pak et al Cell Metab. 2020 Mar 3;31(3):642-653.e6.

March 1, 2021

Academic Institutions and Nonprofits only

#105730

Mammalian expression of mutant human alpha synuclein

Hilal Lashuel

Mbefo et al J Biol Chem. 2015 Apr 10;290(15):9412-27

March 29, 2018

Academic Institutions and Nonprofits only

#179315

Express human melanocortin 4 receptor (GFP tagged) in mammalian cells

Christian Gruber

Muratspahic et al ACS Pharmacol Transl Sci. 2023 Sep 26;6(

Sept. 28, 2023

Academic Institutions and Nonprofits only

#195286

Bicistronic DTR-EGFP fusion and Puromycin resistance for positive/negative selection

Scott Lowe

Barriga et al Nat Cancer. 2022 Nov;3(11):1367-1385. do

Jan. 26, 2023

Academic Institutions and Nonprofits only

#195288

Bicistronic HSV-TK-EGFP fusion and Puromycin resistance for positive/negative selection

Scott Lowe

Barriga et al Nat Cancer. 2022 Nov;3(11):1367-1385. do

Jan. 26, 2023

Academic Institutions and Nonprofits only

#87383

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only