We narrowed to 11,213 results for: AGA
-
Plasmid#52013PurposeUsed for in vitro expression of the human MAVS CDS containing a point mutation L62MDepositorInsertMAVS
ExpressionMammalianMutationChanged Leu 62 to MetAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-E80M-invitro(KaganD99)
Plasmid#52015PurposeUsed for in vitro expression of the human MAVS CDS containing a point mutation E80MDepositorInsertMAVS
ExpressionMammalianMutationChanged Glu 80 to MetAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-α-Synuclein-c_myc
Plasmid#225222PurposeYeast optimized human alpha synuclein fused with aga2 protein gene under gal1 promoter for the expression of alpha synuclein in yeast surface display.DepositorInsertsα-Synuclein
Aga2
TagsGS linker, HA Tag, and c-myc TagExpressionYeastPromoterGAL1Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCTCON2-Aga2p-Flag-CapN-TEVcs-HA
Plasmid#213530PurposeExpresses CapN-caged TEVcs on yeast surfaceDepositorInsertAga2p-Flag-CapN-TEVcs-HA
ExpressionYeastPromoterGal1/10Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBac{3Xtin-GAGA-eGFP,w+,attB}
Plasmid#182195PurposeEGFP driven by tinman and GAGA transcription factor binding sitesDepositorInsertEGFP
ExpressionInsectAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKSB- PUb-NLSmTurqSV40 GGGG AAGA
Plasmid#174535PurposePUb-mTurquoise fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsertPUb-mTurquoise BsaI cassette
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB- PUb-GFPsv40 GGGG AAGA
Plasmid#174536PurposePUb-GFP fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsertPUb-GFP-SV40 BsaI cassette
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB- PUb-GFPTub56D GGGG AAGA
Plasmid#174537PurposePUb-GFP fluorescence marker cassette for gene knock-in in mosquitoes, with DmTub56D terminatorDepositorInsertPUb-GFP-Tub56Dterminator BsaI cassette
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB- PUb-DsRedSV40 GGGG AAGA
Plasmid#174538PurposePUb-DsRed fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsertPUb-DsRed BsaI cassette
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMK-rps2 5'UTR mAAGA (-20 to -10 deletion)
Plasmid#123535PurposeMoChlo kitDepositorInsertrps2 5'UTR mAAGA (-20 to -10 deletion)
UseSynthetic BiologyAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_ORI_AGAP1
Plasmid#99300PurposeLuciferase validation vector with AGAP1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr2: 236735694-236737193 (AGAP1 Human)
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_AGAP1
Plasmid#99301PurposeLuciferase validation vector with AGAP1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr2: 236735694-236737193 (AGAP1 Human)
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_SCP1_AGAP1
Plasmid#99302PurposeLuciferase validation vector with AGAP1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr2: 236735694-236737193 (AGAP1 Human)
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-HA-shift-IRES-GFP(KaganE21)
Plasmid#52004PurposeExpresses the human MAVS CDS containing an N-terminal HA tag and a frameshift mutation inserting TA at bp number 254 of the MAVS CDS . And a GFP markerDepositorInsertMAVS-Shift
UseRetroviralTagsHAExpressionMammalianMutationA 2 nucleotide insertion was introduced between t…Available SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-5'UTR-MAVS-ORF3,4(KaganE50)
Plasmid#52007PurposeExpresses the human MAVS CDS and contains the 5'UTR sequence with a mutation in the start codons 61 and 67 nt downstream of the FL MAVS start codonDepositorInsert5utr-MAVS-ORF2,3mut
ExpressionMammalianMutationmutated start codons for ORF3 and 4Available SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-M1A,M142A(KaganF62)
Plasmid#52002PurposeExpresses the human MAVS CDS containing two point mutations M1A and M142ADepositorInsertMAVS
ExpressionMammalianMutationchanged Met 1 to Ala and Met 142 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-5'UTR-MAVS-ORF1(KaganE49)
Plasmid#52006PurposeExpresses the human MAVS CDS and contains the 5'UTR sequence with a mutation in the start codon 37 nt upstream of the FL MAVS start codonDepositorInsert5utr-MAVS-ORF1mut
ExpressionMammalianMutationmutation removing the start codon for ORF1Available SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-MAVS-M1A,M142A(KaganE20)
Plasmid#52011PurposeExpresses the human MAVS CDS containing the point mutations M1A and M142ADepositorInsertMAVS-M1A,M142A
UseRetroviralExpressionMammalianMutationchanged Met 1 to Ala and Met 142 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Galpha-s-IRESWT-Gbetagamma ONE-GO
Plasmid#204340PurposeGPCR/G protein BRET biosensorDepositorInsertGalpha-s/Gbetagamma ONE-GO
UseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits