We narrowed to 14,605 results for: Ung;
-
-
-
-
-
-
pcDNA3.2 mir-1-1 reporter dme-let-7
Plasmid#46662DepositorInsertdme-let-7
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter dme-mir-34
Plasmid#46665DepositorInsertdme-mir-34
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pEMY01AB-PRO
Plasmid#127714PurposeIntegrative yeast promoter characterization plasmid. Clone in with BpiI. Has ChrXV homology upstream and an mVenus fragment downstream.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pEMY01CD-TER
Plasmid#127751PurposeIntegrative yeast terminator characterization plasmid. Clone in with BpiI. Has mVenus fragment upstream and a KanMX fragment downstream.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pFC332
Plasmid#87845PurposeAMA1 plasmid with Aspergillus optimized Cas9 and hph selection markerDepositorInsertsCas9
hph (hygromycin resistance marker)
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and Aspergillu…Available SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1_EF1a-MitoTrap-mCherry-IRES-Puro
Plasmid#197067PurposeDonor plasmid for human AAVS1 locus knock-in, constitutive expression of MitoTrap-mCherryDepositorInsertMitoTrap-mCherry
UseCRISPRExpressionMammalianAvailable SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB-BbsI-sgRNA
Plasmid#203359PurposeContains BbsI cut sites for placement of user-specified sgRNA target sequences with Sleeping Beauty backboneDepositorInsertBbsI Cut Sites
Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-G3BP1-WT
Plasmid#135997PurposeWT G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cellsDepositorAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCCL-NoPromoter-FLuc-CMV-RLuc-dsRed2
Plasmid#215329PurposeLentiviral mammalian vector with firefly luciferase gene with no upstream promoter sequence; renilla luciferase and dsRed2 reporter under CMV promoter.DepositorInsertNo Promoter
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Hph
Plasmid#188741PurposepUC19 plasmid (MCS intact) with Hygromycin selection markerDepositorInsertHygromycin
UseFilamentous fungal expressionPromotergpdAAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only
