We narrowed to 7,700 results for: aav
-
Plasmid#107549Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression IRES-hrGFPDepositorTypeEmpty backboneUseAAVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV CB6 FFLuc-miR122
Plasmid#35656DepositorAvailable SinceApril 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 ChR2 ET-TC 2A tDimer
Plasmid#101361PurposeHigh efficiency channelrhodopsin, neuron specific promoter, red fluorescent proteinDepositorInsertsChannelrhodopsin-2
synaptophysin-red fluorescent protein
UseAAVExpressionMammalianMutationE123T , T159CPromoterhuman SynapsinAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap-FLEX.SF-Venus-iGluSnFR.A184S
Plasmid#106183PurposeTight affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorHas ServiceAAV1InsertSF-Venus-iGluSnFR.A184S
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184SPromoterhSynapsinAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro Xlone SOX17
Plasmid#179838PurposeDoxycycline-inducible expression of human SOX17DepositorInsertSOX17 (SOX17 Human)
UseAAV, CRISPR, Synthetic Biology, and TALEN ; Donor…ExpressionMammalianPromoterTRE3GSAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN_mMaroon-KIX-mMaroon
Plasmid#137009PurposeAAV backbone, mMaroon-KIX acceptor for R-CREBDepositorAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS2603_AAV-Nme2-ABE8e-i1-U6-Rosa26
Plasmid#201685PurposeAll-in-one AAV plasmid expressing Nme2-ABE8e-i1 and U6 driven sgRNA targeting the mouse Rosa26 geneDepositorInsertNme2-ABE8e-i1
UseAAV and CRISPRExpressionMammalianPromoterU1aAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTBL437 AAVS1 EQR sgRNA
Plasmid#126447PurposeTo cut the human AAVS1 locus for integration.DepositorInsertspacer against human AAVS1 safe-harbor locus with NGAG PAM
ExpressionMammalianPromoterhuman U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Flex-mRuby3-2A
Plasmid#203846PurposeNeuron specific expression of a Cre-dependent mRuby3DepositorInsertmRuby3
UseAAVAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DCX(S306D)-2A-mCherry
Plasmid#118292PurposeExpresses human mutant DCX tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Serine at position 306 substituted for aspartic acidDepositorInsertDoublecortin (DCX Human)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationSerine 306 changed to Aspartic AcidPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DCX(S306A)-2A-mCherry
Plasmid#118291PurposeExpresses human mutant DCX tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Serine at position 306 substituted for alanineDepositorInsertDoublecortin (DCX Human)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationchanged Serine 306 to AlaninePromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-PGD2-1.1
Plasmid#214764PurposeAAV packaging plasmid for GRAB PGD2-1.1 fluorescent sensor under EF1alpha promoterDepositorInsertGRAB-PGD2-1.1 sensor
UseAAVPromoterEF-1-alpha promoterAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP301-pAAV-CMV-MCS3-pA
Plasmid#113676PurposeCMV driven Multi Cloning Site-3DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV Fos YFP MS2
Plasmid#131775PurposeFos upstream msfYFP 24xMS2 Fos downstream for CRISPR taggingDepositorInsertmsfYFP - 24x MS2 loops
UseAAV and CRISPRPromotern/aAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfaABC1D-DreO-4x6T
Plasmid#196413PurposeAstrocytic expression of Dre recombinase in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassetteDepositorInsertDreO
UseAAV; Astrocyte-selectiveExpressionMammalianPromoterCAG and GfaABC1DAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_UCN1.0
Plasmid#208668PurposeExpresses the genetically-encoded fluorescent urocortin (UCN) sensor GRAB_UCN1.0 in neuronsDepositorInsertGPCR activation based urocortin (UCN) sensor GRAB_UCN1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6sgp53-mTSG-GFAPCre
Plasmid#100276PurposeAAV-CRISPR library for pool mutagenesis of top tumor suppressor genesDepositorUseAAV, CRISPR, Mouse Targeting, and Synthetic Biolo…ExpressionMammalianAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV Ef1a-mRuby3-WPRE
Plasmid#135427PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterEf1aAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only