We narrowed to 6,009 results for: pCas
-
Plasmid#178858PurposeMammalian expression of PKCδ-eDHFR(69K6) chimera fused to miRFP670DepositorInsertPKCδ(1-229)-eDHFR(69K6)-PKCδ(280-675)-miRFP670 (PRKCD Human)
ExpressionMammalianPromoterCAGAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_162 SpCas9 KES(1107-1109)GG
Plasmid#179526PurposeFor bacterial expression of SpCas9 KES(1107-1109)GG (phosphate lock loop mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 KES(1107-1109)GG
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationreplaced KES (residues 1107-1109) with GGAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Armc12 delta ARM/FLAG
Plasmid#180496PurposeExpression vector of ARM domain deleted mouse Armc12 tagged with FLAG at C-terminus. See Fig.4D of Shimada, K. et al. Proc. Natl. Acad. Sci. USA. 118 (6): e2018355118, 2021.DepositorInsertarmadillo repeat containing 12 (Armc12 Mouse)
TagsFLAG tagExpressionMammalianMutationARM domain of Armc12 is deletedPromoterCAG promoterAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-B2
Plasmid#165083PurposegRNA 2 of pair B for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C1
Plasmid#165085PurposegRNA 1 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C2
Plasmid#165086PurposegRNA 2 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dH85E-cs-TEV-STREP
Plasmid#171838PurposeMammalian expression of human WIPI2d H85E with N-terminal mCherry and C-terminal StrepDepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dK88E-cs-TEV-STREP
Plasmid#171839PurposeMammalian expression of human WIPI2d K88E with N-terminal mCherry and C-terminal StrepDepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dI92E-cs-TEV-STREP
Plasmid#171840PurposeMammalian expression of human WIPI2d I92E with N-terminal mCherry and C-terminal StrepDepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dC93E-cs-TEV-STREP
Plasmid#171841PurposeMammalian expression of human WIPI2d C93E with N-terminal mCherry and C-terminal StrepDepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dR108E-cs-TEV-STREP
Plasmid#171842PurposeMammalian expression of human WIPI2d with N-terminal mCherry and C-terminal StrepDepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dR125E-cs-TEV-STREP
Plasmid#171843PurposeMammalian expression of human WIPI2d R108E with N-terminal mCherry and C-terminal StrepDepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dK128E-cs-TEV-STREP
Plasmid#171844PurposeMammalian expression of human WIPI2d K128E with N-terminal mCherry and C-terminal StrepDepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-PP-squirrel-monkey-CHMP3
Plasmid#154182Purposeexpresses squirrel monkey CHMP3 in mammalian cellsDepositorInsertCHMP3
TagsFLAG, Strep-Tag II, and preScission siteExpressionMammalianPromoterCAGAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-PP-squirrel-monkey-retroCHMP3
Plasmid#154184Purposeexpresses squirrel monkey retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
TagsFLAG, Strep-Tag II, and preScission siteExpressionMammalianPromoterCAGAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only