We narrowed to 3,505 results for: cgas
-
Plasmid#155057PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_As
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_As
Plasmid#155055PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_Lb
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-B
Plasmid#138671PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-3
Plasmid#133403Purposehuman ETV6 gRNA-3 is a 20-nt gRNA expression plasmid targeting the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAPM-D4 miR30-PIWIL2 ts2
Plasmid#115870PurposePIWIL2 knockdownDepositorAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
pHH0103_ARHGAP33-1/1
Plasmid#91341PurposeProtein expression and purification of human SH3 domain construct ARHGAP33-1/1DepositorInsertARHGAP33-1/1 (ARHGAP33 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN150
Plasmid#91679PurposeExpress sgRNA targeting human TSNARE1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only