We narrowed to 16,618 results for: OMP;
-
Plasmid#80277PurposeGAL4->QF2 HACK construct compatible with GMR attP integrated insertions. Contains 5' and 3' GAL4 homology arms and gRNAs.DepositorInsertQF2
ExpressionInsectAvailable sinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBlueBac human APC2
Plasmid#11425DepositorInsertAPC2 (ANAPC2 Human)
UseBaculoviralAvailable sinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pYPQ265E2
Plasmid#164719PurposeGateway entry clone (attL1 & attR5) A3A/Y130F-CBE_V01 for C-T base editingDepositorInsertA3A(Y130F)-zCas9(D10A)-UGI
UseCRISPR; Gateway compatible a3a/y130f-cbe_v01 entr…ExpressionPlantAvailable sinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMK1253
Plasmid#133058PurposeLentiviral vector with EF1A promoter constitutively expressing a single insert containing the Tau.K18(P301L/V337M)-Clover2 fusion protein.DepositorInsertTau.K18(LM)
UseLentiviralTagsmClover2ExpressionMammalianPromoterEF1AAvailable sinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-OSF-VPS15
Plasmid#99326PurposeComponent for mammalian expression of recombinant PI3KC3-C1 complexDepositorAvailable sinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV MP-135 mRFP
Plasmid#206927PurposeThe micro promoter MP-135 is an AAV specific strong promoter for gene expression in mammalian cells. The small size of the promoter (135 bp) allows delivery of large genes in AAV.DepositorInsertmRFP
UseAAVExpressionMammalianPromoterMP-135Available sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pAraH6HATT
Plasmid#63901PurposeFor expression of soluble scFv/Fab fragments in bacteria from genes selected using the pComb3H system, contains TT Fab (light and heavy chains) against tetanus toxin, used as expression control.DepositorInsertTT Fab
Tags6xHis and HA tagExpressionBacterialPromoteraraBADAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a-6xHis-MBP-TEV site-TadA8r
Plasmid#208318PurposeOverxpression MBP-TadA8rDepositorInsertTadA8r
ExpressionBacterialMutationmutations in TadA are described in the paperAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOZ-N-FH KIAA0157
Plasmid#27499DepositorAvailable sinceMarch 1, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOZ-N-FH MERIT40
Plasmid#27498DepositorAvailable sinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CD-MPR-mCherry-RUSH
Plasmid#202798PurposeRUSH cargo: Str-KDEL_IRES_SBP-mCherry-CD-MPRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertM6PR (M6PR Human)
TagsmCherryExpressionMammalianMutationChanged 40 K (AAA) with R (AGA)PromoterCMVAvailable sinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMT-Mef2c-tPT2A-GFP
Plasmid#111771PurposeBicistronic construct: Co-express two genes by 2A peptidesDepositorAvailable sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
mNeonGreen-UtrCH
Plasmid#98879PurposeIn vivo visualization of actin cytoskeleton (can be used for colocalization studies)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUtrCH
TagsmNeonGreenExpressionMammalianMutation*(see below)PromoterCMVAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ166
Plasmid#109328PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zCas9-NLS without promoterDepositorInsertzCas9
UseCRISPR; Gateway compatible zcas9 entry cloneTags3x FLAG, NLS and NLSExpressionPlantMutationZea mays codon-optimized Cas9Available sinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKK-TEV-mRuby3
Plasmid#105797PurposeExpression of your protein of interest in fusion with red fluorescent protein at the C-terminus (cleavable by TEV) (PMID: 26879144). mRuby3 is brighter than mCherry and has shifted ex and em spectra.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mRuby3ExpressionMammalianAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJW1507
Plasmid#62361PurposepFA6a -mVenus-BirA::HIS5DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertc-terminal mVenus-BirA tagging
UseYeast c-terminal tagging vectorTagsmVenus-BirAMutationL232H mutation compared to standard mVenusAvailable sinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA-Nup37-EGFP-polyA
Plasmid#104562PurposeExpress Nup37-EGFP in mammalian cells (CMV promoter). Also suitable for in vitro transcription (T7 promoter) for injecting mRNA into oocytes.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNup37 (Nup37 Mouse)
TagsEGFP tagExpressionMammalianAvailable sinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -