We narrowed to 6,656 results for: &alpha
-
Plasmid#229725PurposeStable transformation or transient expression of gene of interest in plantsDepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pGWB414_35S-(ΔTP)DM3(Hh-0)-HA
Plasmid#229724PurposeStable transformation or transient expression of gene of interest in plantsDepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Col-0)
Plasmid#229714PurposeStable transformation or transient expression of gene of interest in plantsDepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Hh-0)
Plasmid#229713PurposeStable transformation or transient expression of gene of interest in plantsDepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB414_35S-DM3(Col-0)-HA
Plasmid#229712PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Col-0) (AT3G61540 Mustard Weed)
ExpressionPlantAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB414_35S-DM3(Hh-0)-HA
Plasmid#229711PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Hh-0) (AT3G61540 Mustard Weed)
ExpressionPlantAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Col-0) T165I
Plasmid#229726PurposeStable transformation or transient expression of gene of interest in plantsDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET28 His-SUMO-CHMP2B
Plasmid#232018PurposeBacterial expression of His and SUMO tagged CHMP2BDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Col-0) Q345R
Plasmid#229720PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Col-0) (AT3G61540 Mustard Weed)
ExpressionPlantMutationamino acid 1-52 were deleted, Q345RAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Hh-0) S214A
Plasmid#229722PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Hh-0) (AT3G61540 Mustard Weed)
ExpressionPlantMutationamino acid 1-52 were deleted, S214AAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Col-0) S214A
Plasmid#229723PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Col-0) (AT3G61540 Mustard Weed)
ExpressionPlantMutationamino acid 1-52 were deleted, S214AAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Col-0) T359A
Plasmid#229727PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Col-0) (AT3G61540 Mustard Weed)
ExpressionPlantMutationamino acid 1-52 were deleted, T359AAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
3020_pETcon-SARS-CoV-2-RBD_N501Y
Plasmid#184405Purposeyeast surface display of the SARS-CoV-2 Alpha variant RBDDepositorInsertSARS-CoV-2 Alpha Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationN501YAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GABARα6N-HA
Plasmid#128111PurposeExpress HA tagged GABARα6 N terminal domainDepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFBD-Btk(PH)Akt1(KD)
Plasmid#86591PurposeExpresses chimeric fusion of PH domain of Btk and kinase domain of Akt1DepositorAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001145757)
Plasmid#76416Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001149070)
Plasmid#76417Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-Gb2-K
Plasmid#25759PurposeEntry vector with human U6 promoter driving both mouse G alpha 12 and G alpha 13 miR30-based shRNAs.DepositorInsertGb2 miR-shRNA (Gnb2 Mouse)
UseEntry vectorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
R777-E172 Hs.PIK3R1-nostop
Plasmid#70456PurposeGateway ORF clone of human PIK3R1 [NM_181523.2] without stop codon (for C-terminal fusions)DepositorInsertPIK3R1 (PIK3R1 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only