We narrowed to 3,022 results for: ER
-
Plasmid#236237PurposeAAV expression of human Junctophilin3 N-terminally tagged with mCherryDepositorInsertJunctophilin 3 (JPH3 Human)
UseAAVTagsmCherryExpressionMutationPromoterhuman Synapsin 1Available sinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-CE-ABE8e-SpRY--BPNLS-P2A-EGFP (NK289)
Plasmid#208293PurposeCMV and T7 promoter expression plasmid for human codon optimized CE-ABE8e-SpRY A-to-G base editor and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-CE-ABE8e-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA inlaid into nSpRY(D10A/A6…PromoterCMV and T7Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP (CA136)
Plasmid#208291PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpRY(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpRY(D10A/…PromoterCMV and T7Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pN1 Lck-GCaMP5G
Plasmid#34924PurposeExpresses a fusion between the Lck domain and cytosolic GCaMP5G. This construct targets GCaMP5G to the plasma membraneDepositorInsertLck-GCaMP5G
UseTagsExpressionMammalianMutationPlasmid contains N-terminal 26 amino acid membran…PromoterCMVAvailable sinceFeb. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.iGluSnFR3.v857.PDGFR.codonopt
Plasmid#175180PurposeFluorescent reporter for glutamate, third generation, variant 857. iGluSnFR3.v857DepositorHas ServiceAAV1InsertpAAV hSyn FLEX iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianMutationPromoterhuman SynapsinAvailable sinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iGluSnFR3.v857.SGZ
Plasmid#178334PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV CAG iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianMutationPromoterAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.iGluSnFR3.v857.SGZ.codonopt
Plasmid#175182PurposeFluorescent reporter for glutamate, third generation, variant 857 in Stargazin (SGZ) backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV hSyn FLEX iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianMutationPromoterhuman SynapsinAvailable sinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP7c variant 1513-WPRE
Plasmid#105323PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the CAG promoter, Cre-dependent expressionDepositorInsertjGCaMP7c variant 1513
UseAAV and Cre/LoxTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianMutationPromoterCAGAvailable sinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE
Plasmid#105322PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the Syn promoter, Cre-dependent expressionDepositorHas ServiceAAV1InsertjGCaMP7c variant 1513
UseAAV and Cre/LoxTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianMutationPromoterSynapsinAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6-PGK-hCD2
Plasmid#224294PurposeExpresses sgRNA from U6 promoter and human CD2 under PGKDepositorInsertU6 sgRNA cassette with CD2 under PGK promoter (CD2 Human)
UseCRISPR and RetroviralTagsExpressionMammalianMutationPromoterU6/PGKAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.iGluSnFR3.v857.IgK-NGR
Plasmid#196226PurposeFluorescent reporter for glutamate, third generation, variant 857 in NGR backbone. iGluSnFR3.v857.NGRDepositorInsertpAAV hSyn FLEX iGluSnFR3 v857.NGR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and NGR TM DomainExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMWCAVI_H6BAP-OROV_N
Plasmid#240162PurposePlasmid encoding Oropouche virus (OROV) nucleoprotein (N) with an N-terminal His6 and biotin acceptor peptide (BAP, a.k.a. AviTag) for expression in E. coliDepositorInsertNucleoprotein
UseTags6xHis, Biotin acceptor peptide (BAP, a.k.a. AviTa…ExpressionBacterialMutationPromoterAvailable sinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOPTH OROV N
Plasmid#229663PurposeExpress Oropouche virus BeAn 19991 nucleoprotein with N-terminal His6 tagDepositorInsertNucleoprotein
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mScarlet-STIM2 WPRE
Plasmid#236236PurposeAAV expression of human STIM2 internally tagged with mScarlet-IDepositorInsertmScarletI-STIM2 (STIM2 Human)
UseAAVTagsmScarletI in position 29ExpressionMutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-STIM2 WPRE
Plasmid#236235PurposeAAV expression of human STIM2 internally tagged with HaloTagDepositorInsertHaloTag-STIM2 (STIM2 Human)
UseAAVTagsHaloTag in position 29ExpressionMutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP2
Plasmid#184557PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialMutationPromoterAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-PTDSS1-IRES-puromycin-pLVx-EF1a
Plasmid#177435PurposeTo express mCherry fused to PTDSS1, a protein that localized to mitochondria associated ER membranes (MAMs). Lentiviral vector used to make cell lines expressing this MAM landmark.DepositorInsertPhosphatidylserine synthase-1, PTDSS1, LMHD, PSS1, PSSA (PTDSS1 Human)
UseLentiviralTagsmCherryExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only