We narrowed to 9,048 results for: sgRNA
-
Plasmid#183877PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only
-
LV-U6-sgRNAfiller-PGK-Cre-EFS-mScarletSIIN
Plasmid#172436PurposeLentivirus, expresses Cre recombinase and mScarlet-SIINFEKL, with sgRNA cloning siteDepositorInsertsCre
mScarlet-SIINFEKL(OVA257-264)+Ova 323-339
UseCRISPR and LentiviralAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-wtSpCas9 (without sgRNA)
Plasmid#92353PurposeExpression plasmid for human codon-optimized wild-type SpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFlag-NLS-wild-type SpCas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-P2A-EGFP_mRFPstuf
Plasmid#137730PurposeExpresses customizable S. Pyogenes sgRNA from U6 promoter and PuroR-P2A-EGFP from EF-1a promoter. Stuffer contains mRFP from a bacterial promoter, enabling simple visual quality control step of sgRNADepositorTypeEmpty backboneUseCRISPR, Lentiviral, Mouse Targeting, and Syntheti…ExpressionBacterial and MammalianAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-MYH10_sgRNA
Plasmid#183887PurposepX459V2.0-HypaCas9 plasmid with MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-MYH10_sgRNA
Plasmid#183886PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0075
Plasmid#117560PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting Rpn2/Psmd1 subunit {AT2G32730} in A. thalianaDepositorInsertPromoter_AtU6-26 + sgRNA_Rpn2/Psmd1 subunit {AT2G32730} A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0027
Plasmid#117558PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting AtADH gene gene in A. thaliana with 1 mismatch at PAMDepositorInsertPromoter_AtU6-26 + sgRNA_atADH1{At1G77120) _1mismatch in PAM A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately (MYC Human)
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNORg504
Plasmid#249345PurposeMediterraneibacter gnavus CRISPR-cas9 mutagenesis plasmidDepositorInsertssgRNA - cas9
homology arm for srtB4 deletion
UseE. coli - r. gnavus shuttle vectorAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only