We narrowed to 353 results for: Ky
-
Plasmid#103004Purposenon-standard AAV2 rep-AAV-PHP.B3 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B3 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B2
Plasmid#103003Purposenon-standard AAV2 rep-AAV-PHP.B2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B2 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
iCAP-BI-48-KanR
Plasmid#203533PurposeRepCap for AAV productionDepositorInsertAAV-BI48 Cap
UseAAVExpressionMammalianAvailable SinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
iCAP-BI-62-KanR
Plasmid#203535PurposeRepCap for AAV productionDepositorInsertAAV-BI62 Cap
UseAAVExpressionMammalianAvailable SinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P-1-SF2
Plasmid#99020PurposeBacterial expression of SF2DepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNeuLite
Plasmid#16247DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-tTA
Plasmid#127091PurposeAn AAV genome with Cre-dependent expression of tTA from the CAG promoterDepositorInserttTA
UseAAVExpressionMammalianMutation*(see below)PromoterCAGAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCINeo-mCHMP5
Plasmid#11771DepositorInsertchromatin modifying protein 5 (Chmp5 Mouse)
ExpressionMammalianAvailable SinceMay 12, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-15b-LanCL1
Plasmid#154189PurposeTo express LanCL1 in bacterial cellsDepositorInsertLanCL1
TagsHexahistidineExpressionBacterialAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-tdTomato-f
Plasmid#127092PurposeAn AAV genome with tet-inducible, Cre-dependent expression of farnesylated (f) tdTomatoDepositorInserttdTomato-f
UseAAVTagsfarnesylation signal from c-Ha-RasExpressionMammalianAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGMEH-T38M-750-luxAB-DAS+4
Plasmid#49520PurposeHygromycin resistant; expresses luxAB-DAS+4 under the control of a promoter containing PtetO-4C5G; constitutively expresses reverse TetR (tetR38); replicates episomallyDepositorInsertT38M-P750-luxAB-DAS+4
TagsDAS+4 (AANDENYSENYADAS)ExpressionBacterialAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-RVdG-MCP:oScarlet:KASH-6xMBS
Plasmid#231011PurposeCVS N2c RVdG genome plasmid. Utilizes MS2 tagging to deliver the MCP:oScarlet:KASH transcript to the outer nuclear membrane. Insert high complexity barcode between SacII RE sites distal to 6xMBS site.DepositorInsertMCP-oScarlet-KASH-6xMBS-SacIIMCS
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-RVdG-MCP:oScarlet-KASH_NoMBS
Plasmid#231014PurposeCVS N2c RVdG genome plasmid, utilized to generate negative control virus to benchmark the utility of MS2 tagging for capture of barcodes using snRNA-seq.DepositorInsertMCP-oScarlet-KASH
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Aga2p-TEVcs-LacAnc100-myc_pCTCON2
Plasmid#245298Purposeexpresses LaccID on the yeast surfaceDepositorInsertAga2p-LacAnc100
ExpressionYeastAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SS-HA-V5-LacAnc100-CD4 TM_pDisplay
Plasmid#245299Purposeexpresses LaccID on the mammalian cell surfaceDepositorInsertLacAnc100-CD4TM
ExpressionYeastAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNF-KB-Split PS Intein-C tTA
Plasmid#242035PurposeC-terminal segment of a blue-light-controlled split PS Intein tTA gene expression system, co-expressing mCherry under an NF-KB-inducible promoterDepositorInsertSplit PS Intein-C tTA
TagsmCherryExpressionMammalianMutationThe CMV promoter in the original vector was repla…PromoterNF-KBAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30-LacAnc100
Plasmid#234653PurposeExpresses LacAnc100 variant in yeastDepositorInsertLacAnc100
TagsHRV 3C protease site-GSG linker-8xHis tagExpressionYeastPromoterGal1pAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only