-
Plasmid#163769PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette under the pH promoter.DepositorInsertno insert
UseTagsno tagExpressionInsectMutationPromoterPHAvailable sinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
ND4 right TALE–G1333 DddAtox N
Plasmid#158096Purposeexpresses the right-side ND4 TALE–DddAtox half in mammalian cellsDepositorInsertCOX8A MTS–3xFLAG–ND4 right TALE–G1333 DddA tox-N–1xUGI
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’VIM-eGFP-KI
Plasmid#170547PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP flanked by homology arms for VIMDepositorInsertsLeft Homology arm for VIM knockin
Right Homology arm for VIM knockin
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dynactin-4/p62-3XHA
Plasmid#31058DepositorInsertDynactin-4 (DCTN4 Human)
UseTags3XHAExpressionMammalianMutationPromoterAvailable sinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11-MMEJ
Plasmid#207760PurposeMMEJ donor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Short Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
sgRNA1_IL1RN
Plasmid#64140PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertIL1RN (IL1RN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMGIB-HA-hTCAB1
Plasmid#167460PurposeRetroviral expression of HA-TCAB1 (WDR79) in mammalian cellsDepositorInsertTCAB1 (WRAP53 Human)
UseRetroviralTagsHAExpressionMammalianMutationPromoterAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P81nmt1-GFP
Plasmid#39291DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…ExpressionMutation-1163 to +6 of nmt1 locus with a 7bp deletion (AT…PromoterAvailable sinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
KJ901: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS
Plasmid#121835PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
TC1092
Plasmid#164879PurposeCMV-dcas13d-NLS-ADARdd- mCherryDepositorInsertdcas13d-ADARdd
UseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_IL1RN
Plasmid#64151PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA3_IL1RN (IL1RN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 _HITI donor B6
Plasmid#172847PurposeDRS-2 sgRNA expression under a U6 promotor and HITI donor B6 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and HITI donor (phase 1) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIneoLuc-PP1A
Plasmid#128348PurposeVector for LUMIER assayDepositorInsertPP1A (PPP1CA Human)
UseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
IF311: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-LSD1
Plasmid#121824PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 PA-mCit
Plasmid#113443PurposeProteinA-mCitrine control expression vectorDepositorInsertProteinA-mCitrine
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_Omega2_Pnos:GR:LacIBD:Gal4AD:Tnos-OplacI:mini35S:RDF:Tnos (GB1678)
Plasmid#160642PurposeModule for the dexamethasone -inducible expression of PhiC31 phage recombination directionality factor (RDF) gene.DepositorInsertGRLacIBDGal4AD / RDF
UseSynthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-cdk2-guides
Plasmid#168250Purpose"neutrophil specific GFP with ubiquitous cdk2 sgRNAs"DepositorInsertcdk2 sgRNAs
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p1.1-Tr2-eGFP
Plasmid#162782PurposeFluorescent reporter for protein expression studiesDepositorInsertenhanced green fluorescent protein
UseTagsExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available sinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CNTF
Plasmid#195338PurposeExpression of CNTF in mammalian cellsDepositorInsertCiliary neurotrophic factor (CNTF Human)
UseAAVTagsNGF signal peptideExpressionMammalianMutationPromoterUbC promoter with beta-globin intronAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIRESneo-MPG(N169D)
Plasmid#23259DepositorInsertN-methylpurine DNA glycosylase (N169D) (MPG Human)
UseTagsExpressionMammalianMutationN169DPromoterAvailable sinceMarch 31, 2010AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-RacFRET-U6ac-rac2 guides
Plasmid#168248Purpose"label active Rac under Rac2 neutrophil-specific knockout background"DepositorInsertRacFRET
UseZebrafish expressionTagsExpressionMutationPromoterLyzCAvailable sinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2_IL1RN
Plasmid#64142PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA2_IL1RN (IL1RN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA4_IL1RN
Plasmid#64152PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA4_IL1RN (IL1RN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_rSERT_WT
Plasmid#190743PurposeFor expression of wild-type rat SERT in mammalian cellsDepositorInsertSLC6A4 Serotonin Transporter (Slc6a4 Rat)
UseTagsFLAG, His6, and c-mycExpressionMammalianMutationPromoterCMVAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-ONL
Plasmid#65713PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-ONL)DepositorInsert7xTcf, minCMV, 3xNLS, ONL
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
IX301: pMVP (L3-L2) myc epitope tag + polyA
Plasmid#121753PurposepMVP L3-L2 entry plasmid, contains myc epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertmyc epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB007
Plasmid#119705PurposePromoter gpdA from Aspergillus nidulans domesticated into pUPD2 with GGAG/AATG barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformation.DepositorInsertPromoter gpdA
UseSynthetic Biology; Domestication of dna parts for…TagsExpressionMutationPromotergpdAAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-CH115gp160-QES.c14-754*
Plasmid#123282PurposeMammalian expression plasmid for Env from the CH115 HIV-1 isolate; C-terminal truncation; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (CH115) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [n] (GB1207)
Plasmid#75408PurposetRNA and scaffold for the assembly of GBoligomers for the last position (positon [n]) of a polycistronic tRNA-gRNA (2- and 3-part multiplexing)DepositorInserttRNA-gRNA position [n]
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
IX601: pMVP (L3-L2) FLAG epitope tag + polyA
Plasmid#121751PurposepMVP L3-L2 entry plasmid, contains FLAG epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertFLAG epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ401: pMVP (L3-L2) P2A-Neo + polyA
Plasmid#121781PurposepMVP L3-L2 entry plasmid, contains Neo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Neo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Neo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ601: pMVP (L3-L2) P2A-Zeo + polyA
Plasmid#121783PurposepMVP L3-L2 entry plasmid, contains Zeo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Zeo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Zeo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_S212N
Plasmid#113951Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
UseTagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, S212N substitutionPromoterCMVAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSC-NF8-d1-eGFP
Plasmid#122036PurposeAAV vector, NFkappaB-dependent eGFP expressionDepositorInserteGFP
UseAAVTagsExpressionMutationPromoterAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PatoM-LOG241
Plasmid#72847PurposeInduced by acetoacetate to express GFP using atoSC two-component system in E. coli. Contains the atoDAEB promoter (Pato) with a strong RBS, Shine-Dalgarno sequence provided in OG241. LOG241 backbone.DepositorInsertPatoM
UseTagsExpressionBacterialMutationPromoterPatoMAvailable sinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 attP:TMtb:P35S:attB (GB1494)
Plasmid#160577Purpose35S promoter sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attP and attB)DepositorInsertPhiC31 PB (attP:TMtb:P35S:attB)
UseSynthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
KO401: pMAGIC (R4-R3) NLS-x Cas9(3.7)-NLS
Plasmid#121834PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS xCas9(3.7) (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-Cas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:EDLL:tNos (GB1190)
Plasmid#75404PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the EDLL Transcriptional ActivatorDepositorInsertdCas:EDLL
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRRL-pEF-H2B-mCherry-T2A-rTetR-DNMT3L-SV40
Plasmid#186967PurposeLentiviral vector encoding DNMT3A recruiter for methylation reporter (pEF-H2B-mCherry-T2A-rTetR-DNMT3L-SV40) for expression in mammalian cells.DepositorInsertDNMT3L (DNMT3L Synthetic, Human)
UseLentiviralTagsrTetR fusionExpressionMammalianMutationPromoterEF-1alpha promoterAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
FB029
Plasmid#119713PurposePromoter paf from Penicillium chrysogenum domesticated into pUPD2 with GGAG/AATG barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformation.DepositorInsertPromoter paf
UseSynthetic Biology; Domestication of dna parts for…TagsExpressionMutationPromoterPromoter pafAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB030
Plasmid#119714PurposeTerminator paf from P. chrysogenum domesticated into pUPD2 with GCTT/CGCT barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformationDepositorInsertTerminator paf
UseSynthetic Biology; Domestication of dna parts for…TagsExpressionMutationPromoterAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA601: pMVP (L3-L2) P2A-Puro + WPRE
Plasmid#121785PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to a gene in lentivirus vectorsDepositorInsertP2A-Puro + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTW080
Plasmid#115928PurposeSGP insert for replicon MoCloDepositorInsertLvl0 -98/30 SGP NA (No Aptamer)
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cacnb4-GFP KI
Plasmid#139663PurposeEndogenous tagging of CaVβ4: C-terminal (amino acid position: H417)DepositorInsertgRNA and GFP donor
UseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-agrBD-IV
Plasmid#53440PurposeDerivative of pT7-agrBD-I with a point mutation in the agrD gene to change AIP coding region from type-I to type-IVDepositorInsertagrBD locus (with D29Y mutation in agrD)
UseSynthetic BiologyTagsV5 epitope, 6x HIS (not expressed on agrB or agrD…ExpressionBacterialMutationD to Y mutation of residue 29 of the agrD gene (c…PromoterT7-lacAvailable sinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
KZ501: pMVP (L3-L2) P2A-Puro + polyA
Plasmid#121780PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to gene of interest.DepositorInsertP2A-Puro + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MA-VN
Plasmid#123283PurposeMammalian expression plasmid for matrix domain of HIV-1 Gag fused to the N-terminal half of split fluorescent Venus (VN)DepositorInsertMatrix
UseTagsVN: N-terminus of split Venus (a.a. V1–A154) I152…ExpressionMammalianMutationPromoterCMVAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUAST-HA, Pbl-A
Plasmid#69792PurposePebble isoform A in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPebble - Drosophila guanine nucleotide exchange factor
UseP element-based puast vector for gal4-regulated e…TagsHA tagExpressionInsectMutationEncodes Pbl (NP_729306.1) lacking last 9 amino ac…Promoterhsp70 promoterAvailable sinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only