We narrowed to 18,230 results for: multi
-
Plasmid#87937PurposeCo-expression in S.cerevisiae of 4CL5 and AtSCTDepositorInsertsExpressionYeastAvailable SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pSLQ10714
Plasmid#183959PurposeU6-crKlf4-CAG-hyperdCas12a-miniVPRDepositorInsertsHyperdCas12a
crRNA targeting Klf4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-ONL
Plasmid#65713PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-ONL)DepositorInsert7xTcf, minCMV, 3xNLS, ONL
UseLuciferaseAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTK-EdnrbE2-Sox10-FLAG-tev-AVI
Plasmid#127775PurposeModified pTK plasmid containing chicken EdnrB E2 enhancer driving expression of full length Chicken Sox10 in frame with a Flag-tag and Avi-tagDepositorAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV loxP L5-L2
Plasmid#62094PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and multiple cloning site flanked by loxP sites. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCre/Lox; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-Lag16-fibcon-iCAM1-tether
Plasmid#205213PurposeThis vector encodes of the synCAM tether (fibcon - iCAM1) and GFP nanobody LAG16DepositorInsertsynCAM fibcon - iCAM1 Tether and Lag16 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2
Plasmid#186413PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined NLSLacZ under control of an AttB3/B5 recombined reg. sequence.DepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3_mTq-Tat (c-plasmid)
Plasmid#127635PurposeEncodes a fluorecent protein with an RNA binding peptide: mTurquoise2-tat.Expression with constitutive E. coli RNAP promoter (J23106), ribozyme PlmJ and RBS BBa_B0034.DepositorInsertmTurquoise2
UseSynthetic BiologyTagsRNA binding peptide: PCP and RNA binding peptide:…ExpressionBacterialAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
CoxVIIIx2-CeNL(Ca2+)_1.2μ-pcDNA3
Plasmid#111922PurposeCyan color luminescent indicator for calcium signaling.Mitochondrial targeting signals of subunit VIII of human cytochrome c oxidase (CoxVIII) were fused at the N-terminus of CeNL(Ca2+)_1.2μDepositorInsertCeNL(Ca2+)_1.2μ
TagsCoxVIIIx2ExpressionMammalianMutationE67D, E104D, D133E at CaMPromoterCMVAvailable SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSL1425 (pSPIN, pCDF backbone)
Plasmid#160735PurposeSingle-plasmid V. cholerae CAST system, encodes all proteins, crRNA, and donor DNA. Entry vector encodes non-targeting crRNA and has BsaI sites for spacer cloning. pCDF backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSL1142 (pSPIN, pBBR1 backbone)
Plasmid#160730PurposeSingle-plasmid V. cholerae CAST system, encodes all proteins, crRNA, and donor DNA. Entry vector encodes non-targeting crRNA, with BsaI sites for spacer cloning. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHSE401
Plasmid#62201PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-hMLH1dn-Hygro
Plasmid#195512PurposeLentiviral expression plasmid of hMLH1dn with P2A-HygroR markerDepositorInserthMLH1dn-P2A-HygroR (MLH1 Human)
UseLentiviralTagsP2AExpressionMammalianMutationHuman MLH1 del754-756PromoterEF-1aAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSL1521 (pSPIN, pSC101* backbone)
Plasmid#160729PurposeSingle-plasmid V. cholerae CAST system. Encodes all proteins, crRNA, donor DNA; non-targeting crRNA has BsaI sites for cloning. Temperature-sensitive pSC101* backbone can be cured by 37 °C incubation.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSE401
Plasmid#62202PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Kan resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#159281PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)DepositorInsertAsCpf1-HA-2A-GFP
UseMulticistronic vector with both caggs promoter-dr…Tags3X HAExpressionMammalianPromoterU6Available SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3- SREBP-1
Plasmid#204192PurposeMammalian expression of SREBP-1 (isoform 1)DepositorInsertSREBP-1 (SREBF1 Human)
TagsE-tag and T7x2ExpressionMammalianMutationmultiple silent mutationsAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
RGB-S reporter
Plasmid#207841PurposeA three-colour stress biosensor for real time analysis of physiological stress, genotoxicity, and cytotoxicity of Escherichia coliDepositorInsertsRpoH sensing construct
SOS sensing construct
RpoS sensing construct
ExpressionBacterialPromoterPosmY, PsulA, and grpEAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only