We narrowed to 6,677 results for: human c myc
-
Plasmid#101402PurposeDonor Vector containing HOXD8 transcription factor, part of the Human TFome CollectionDepositorInsertHOXD8 (HOXD8 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ETV3
Plasmid#88804PurposeDonor Vector containing ETV3 transcription factor, part of the Human TFome CollectionDepositorInsertETV3 (ETV3 Human)
UseGateway donor vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRES:hTRAAK
Plasmid#133080PurposeMammalian expression vector. It will generate the human TRAAK channel full lengthDepositorInsertPotassium channel subfamily K member 4 (KCNK4, TRAAK) (KCNK4 Human)
ExpressionMammalianAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a/Cas9-Cys
Plasmid#53261PurposeExpresses N-terminal His tag fused human codon-optimized Cas9 nuclease having C-terminal CysteineDepositorInsertCas9-Cys
Tags6X His tag, HA epitope, and NLSExpressionBacterialMutationAdditional Cysteine is added to the C-terminal re…PromoterT7 PromoterAvailable SinceJune 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shNS
Plasmid#127696PurposeDoxycyclin inducible pTRIPZ lentivirus vector containing a non-silencing sequence for both human and mouseDepositorInsertshNS
UseLentiviralExpressionMammalianAvailable SinceNov. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shTREX1
Plasmid#127700PurposeDoxycyclin inducible shRNA knockdown of both human and mouse TREX1 geneDepositorAvailable SinceFeb. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-28c(+)-YTHDF3
Plasmid#102276PurposeFor bacterial expression of His-tagged human YTHDF3DepositorAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shPIK3CD.v1 puro
Plasmid#58706PurposeLentiviral shRNA vector for knockdown of human PIK3CDDepositorAvailable SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shPIK3CD.v2 puro
Plasmid#58707PurposeLentiviral shRNA vector for knockdown of human PIK3CDDepositorAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
ppih.001.177.W133A
Plasmid#137655PurposeExpresses N-terminal GST-(His)6-Thrombin cleavage site fusion of human gene or portion of gene with point mutation in bacterial strains. pET based vector.DepositorAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKWT
Plasmid#216540PurposeThis retroviral plasmid expresses the human wild type PTK2DepositorAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACTA2_HL-P2A-eGFP-PGK-PuroR-ACTA2_HR
Plasmid#126705Purposedonor vector for targeting a 2A peptide followed by green fluorescent reporter to the human ACTA2 locus at the end of the endogenous coding sequenceDepositorInsertGFP
UseCRISPRAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
VEGFR2-mCh
Plasmid#108854PurposeEncodes for human VEGFR2 fluorescently labeled with mCherry on the C-Terminus via a 3 amino acid (GGS) flexible linkerDepositorAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
VEGFR2-YFP
Plasmid#108853PurposeEncodes for human VEGFR2 fluorescently labeled with eYFP on the C-Terminus via a 3 amino acid (GGS) flexible linkerDepositorAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-RNMT 1-120
Plasmid#112706PurposeExpresses N-terminally FLAG-tagged human RNMT 1-120 in mammalian cellsDepositorInsertRNMT (RNMT Human)
TagsFLAGExpressionMammalianMutationdeleted amino acids 121-476PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-RNMT 121-476
Plasmid#112707PurposeExpresses N-terminally FLAG-tagged human RNMT 121-476 in mammalian cellsDepositorInsertRNMT (RNMT Human)
TagsFLAGExpressionMammalianMutationdeleted amino acids 2-120PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSF-DUET-C17orf53_1-87-Strep
Plasmid#211433Purposebacterial expression of the N-terminal amino acids 1-87 of human C17orf53 C-terminally fused to a Strep-TagDepositorAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-PKMYT1-V5_IDG-K
Plasmid#135248PurposeGateway destination clone of PKMYT1 (human) tagged with C-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertPKMYT1-V5 (PKMYT1 Human)
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianPromoterUbiquitinAvailable SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only