We narrowed to 18,207 results for: puro
-
Plasmid#192683PurposeLentiviral expression of multi gNAs targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNAs #1,2,3 (MYOD1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro-HA-PIK3CA(H1047R;G320E)
Plasmid#33254DepositorInsertPIK3CA (PIK3CA Human)
UseRetroviralTagsHemagglutinin (HA)ExpressionMammalianMutationchanged histidine 1047 to arginine and glycine 32…PromoterSV40Available SinceJan. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2AmCherry-W
Plasmid#163177PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
1120 pBabe puroL HA FKHR H215R
Plasmid#9026DepositorAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-hgp100-PuroR [M1G]
Plasmid#171801PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-hgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
H446 EF1a RA-ABE6.3 p2A Puro
Plasmid#139104PurposeLentiviral expression of ABE6.3.DepositorInsertABE RA6.3
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBABE-2xFLAG-2xSTREP-CCND2-Puro
Plasmid#172628PurposeRetroviral vector for the constitutive, near-physiological expression of 2xFLAG-2xSTREP-tagged cyclin D2 and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX-MAPKAP1.1-FHH-IRES-Puro
Plasmid#120705PurposeExpresses MAPKAP1.1-Flag-HA-6xHIS fusion protein in mammalian cells & for virus productionDepositorInsertMAPKAP1 Isoform 1
UseLentiviralTagsFlag-HA-6xHISExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro H-Ras 12V (37G)
Plasmid#12589DepositorAvailable SinceSept. 21, 2006AvailabilityAcademic Institutions and Nonprofits only -
integrin beta6 Y774F pBabe puro
Plasmid#13599DepositorAvailable SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11-MMEJ
Plasmid#207760PurposeMMEJ donor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Short Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Direct-seq_lentiGuide-Puro-Tail-8A8G
Plasmid#157981PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Tail-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBRPy CAGGS-Mbd3-IRES-PURO
Plasmid#52376PurposeMammalian expression vector for constitutive expression of Mbd3DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPuro3.1(+)_Strep-Lrrk2(delGTPase)-Myc
Plasmid#161587Purposeexpression of Myc-tagged mouse Lrrk2 without GTPase domainDepositorInsertLrrk2 (Lrrk2 Mouse)
TagsMyc tag and StrepIIExpressionMammalianMutationdeletion: AA1023-1879PromoterCMVAvailable SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPuro3.1(+)_Strep-Lrrk2(delKinase)-Myc
Plasmid#161586Purposeexpression of Myc-tagged mouse Lrrk2 without kinase domainDepositorInsertLrrk2 (Lrrk2 Mouse)
TagsMyc tag and StrepIIExpressionMammalianMutationdeletion: AA1871-2540PromoterCMVAvailable SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBABE-2xFLAG-2xSTREP-CCND3-Puro
Plasmid#172622PurposeRetroviral vector for the constitutive, near-physiological expression of 2xFLAG-2xSTREP-tagged cyclin D3 and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-Puro-Luci
Plasmid#31850DepositorInsertLuciferase RNAi
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
Ef1a-somBiPOLES-mCerulean-IRES-Puro
Plasmid#192585Purposelentiviral vector for bidirectional optogenetic manipulation of Cre-positive neuronsDepositorInsertsomBiPOLES
UseLentiviralTagssoma-targeting motif from Kv2.1 channelExpressionMammalianPromoterEf1-alphaAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIVTR(T7A)-CRE-T2A-PuroR
Plasmid#172298PurposeIn vitro transcription of CRE-T2A-PuroR synthetic construct for the excision of floxed cassettesDepositorInsertCRE-T2A-PuroR
UseCre/LoxPromoterT7 promoter A-initiatingAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hARAF-shRNA-1
Plasmid#185370PurposeFor tetracycline-inducible mammalian expression of shRNA: GCCGTGACCAGATTATCTTTA that targets human ARAFDepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only