We narrowed to 643 results for: Adh1
-
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ2
Plasmid#197415PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-2 σ2 fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-2 σ2
UseTagsGAL4-DNA binding domain fragment, HA tag, and nuc…ExpressionYeastMutationencodes R42G substitution, contains silent substi…PromoterADH1 and MET25Available sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTH733-2µ-RLuc/maxCFLuc
Plasmid#40608DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH734-2µ-RLuc/stopCFLuc
Plasmid#40609DepositorInsertsFirefly Luciferase (nonsense mutant)
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-mVenus-FLAG-LANS1-Set2
Plasmid#122003PurposemVenus-FLAG-LANS-Set2: mVenus- and FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInsertmVenus-FLAG-LANS1-Set2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsmVenus-FLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-FLAG-LANS1-Set2
Plasmid#122002PurposeFLAG-LANS-Set2: FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInserthistone methyltransferase SET2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsFLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH748-CEN-RLuc/min8maxCFLuc
Plasmid#38214DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first eight codons of the original FLuc gene …PromoterADH1 and TDH3 (=GDP)Available sinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH731-2µ-RLuc/minCFLuc
Plasmid#40601DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH753-CEN-RLuc/min346maxCFLuc
Plasmid#38219DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first 346 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH747-CEN-RLuc/min4maxCFLuc
Plasmid#38213DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first four codons of the original FLuc gene w…PromoterADH1 and TDH3 (=GDP)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pVG50
Plasmid#164708PurposeyEVenus under the control of tetOpr with ADH1t upstream of the reporterDepositorInsertADH1t - tetOpr - yEVenus - CLN2 PEST - ADH1t
UseTagsExpressionYeastMutationPromoterAvailable sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMM0281
Plasmid#128972PurposeEncodes VP16-CIB1 under pADH1 promoterDepositorInsertpscADH1-SV40NLS-VP16-CIB1-tscADH1
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
EZ-L767
Plasmid#131773PurposePADH1_sFUS_Fusion Red_PixD_TACT1DepositorInsertPADH1_sFUS_Fusion Red_PixD_TACT1
UseIntegration into δ-sitesTagsExpressionYeastMutationPromoterPADH1Available sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM0320
Plasmid#128980PurposeEncodes Zif268DBD-CRY2PHR under pscADH1DepositorInsertpscADH1-SV40NLS-ZIF268DBD-CRY2PHR (L3)-tscADH1 TRP1
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNS3
Plasmid#131770PurposePADH1_FUSN_Fusion Red_Cry2Olig_TACT1 for Integration into δ-sitesDepositorInsertPADH1_FUSN_Fusion Red_Cry2Olig_TACT1
UseIntegration into δ-sitesTagsExpressionYeastMutationE490G to make Cry2 into Cry2OligPromoterPADH1Available sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-SKP1-T131A
Plasmid#213482PurposeExpresses human SKP1 T131A mutant in mammalian cellsDepositorInserthuman Flag tagged SKP1-T131A (SKP1 Human)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-24d-Flag-SKP1
Plasmid#213690PurposeExpresses human SKP1 in bacteria cellsDepositorInserthuman Flag tagged SKP1 (SKP1 Human)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag-SKP1-T131D
Plasmid#213600PurposeExpresses human SKP1 T131D mutant in mammalian cellsDepositorInserthuman Flag tagged SKP1-T131D (SKP1 Human)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag-SKP1-T131E
Plasmid#213601PurposeExpresses human SKP1 T131E mutant in mammalian cellsDepositorInserthuman Flag tagged SKP1-T131E (SKP1 Human)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag-SKP1-K142R
Plasmid#213423PurposeExpresses human SKP1 K142R mutant in mammalian cellsDepositorInserthuman Flag tagged SKP1-K142R (SKP1 Human)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag-SKP1-97-101-5A
Plasmid#213642PurposeExpresses human SKP1-97-101-5A mutant in mammalian cellsDepositorInserthuman Flag tagged SKP1--97-101-5A (SKP1 Human)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only