We narrowed to 19,294 results for: cat
-
Plasmid#42204DepositorInsertc-SRC (1-249) (SRC Human)
TagsHAExpressionMammalianMutationcontains amino acids 1-249PromoterCMVAvailable sinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SP6-VEE-OKS-iG
Plasmid#58975PurposeRNA-based iPSC generation. VEE RNA replicon 3'ORF encoding OCT4, KLF4, SOX2 separated by 2A peptides followed by an IRES then GLIS1 and a second IRES and PuroR ORFDepositorUseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Chicken Mermaid S188
Plasmid#53617PurposeGenetically encoded voltage sensor based on mUKG-mKOk FRET pairDepositorInsertChicken Mermaid S188
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable sinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV_hSyn1_nLightR
Plasmid#187180PurposeExpresses red norepinephrine indicator nLightR in neuronal cellsDepositorHas serviceAAV9InsertnLightR
UseAAVTagsFlag tagPromoterhuman Synapsin-1Available sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4f-NGR-WPRE
Plasmid#234442PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorHas serviceAAV1InsertiGluSnFR4f-NGR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-Kv-WPRE
Plasmid#179463PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas serviceAAV9InsertJEDI-2P-Kv
UseAAVExpressionMammalianPromoterhSynAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV.CAG.Flex.NES-jRGECO1b.WPRE.SV40
Plasmid#100855PurposeAAV expression of Cre recombinase-activated jRGECO1b, a red fluorescent calcium sensor protein, from the CAG promoterDepositorInsertjRGECO1b
UseAAVExpressionMammalianPromoterCAGAvailable sinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-jYCaMP1s
Plasmid#135424PurposeYellow protein calcium sensor expressed under human Synapsin1 promoter, for AAV production or direct transfection, slow variantDepositorHas serviceAAV1InsertjYCaMP1s
UseAAVExpressionMammalianPromoterhSynAvailable sinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-jYCaMP1s
Plasmid#135420PurposeYellow protein calcium sensor expressed under human Synapsin1 promoter, Cre mediated flip-excision switch, for AAV production or direct transfection, slow variantDepositorHas serviceAAV1InsertjYCaMP1s
UseAAVExpressionMammalianPromoterhSynAvailable sinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNC1011
Plasmid#42898DepositorInsert3 tandem copies of GFP*
UseYeast integratingMutationchanged Phenylalanine 64 to Leucine, Serine 65 t…PromoterNoneAvailable sinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNC1136
Plasmid#41562DepositorInsertUra3-FUS1-UBIYdkGFP*-SpHis5-Tim9
MutationGFP mutations: Phe 64 to Leu, S65 to Thr, V163 t…Available sinceApril 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBDC
Plasmid#135188PurposeIntegration and excision of chloromaphenicol cassette for the E. coli genome via CreI, SceI, and lamba Red system. Contains SacB selection.DepositorInsertCmR
UseSynthetic BiologyExpressionBacterialMutationNonePromotercatAvailable sinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBP-T7_RBS-His6-Thrombin
Plasmid#72979PurposeT7 promoter, RBS, His6-tag and thrombin cleave site - derived from pET15b (5' CTAT/3' CATA) fusion)DepositorPublicationInsertT7+RBS+His6+thrombin
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-hHSF1 shRNA
Plasmid#118345PurposeThis plasmid expresses shRNA against hHSF1.DepositorAvailable sinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pG6(5'Pro) (P#1477)
Plasmid#14659DepositorInsertUAS repeats
ExpressionBacterialAvailable sinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLQ-KO-tgt50
Plasmid#126578PurposeCRISPR-Cas9 based efficient genome editing in S. aureusDepositorInsertCas9-Pxyltet-sgRNA-Pspac-donor-tgt50
UseCRISPRExpressionBacterialAvailable sinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMS_375
Plasmid#182132Purposeexpresses retron RNA, ec.86 Reverse Transcriptase, CspRecT SSAP, and mutL* to create a specific rifampicin resistance mutation while inhibiting MMRDepositorInsertsretron RNA
ec.86 RT
CspRecT
Mutationincorporated rifampicin-resistance-conferring don…Available sinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pattB-LSL-AAVR-F2A-spCas9
Plasmid#202459PurposeThe plasmid backbone used to generate the recombination template to generate the SELECTIV mice through Integrase Mediated Transgenesis. Allows for Cre-dependent expression of AAVR and Cas9.DepositorInsertAAVR (AU040320 Mouse)
UseCRISPR, Cre/Lox, and Mouse TargetingTagsmCherry fusionExpressionMammalianPromoterCAGAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS4134
Plasmid#131747PurposeHuman reduced folate transporter 1 SLC19A1 for lentiviral transduction, copGFP transduction markerDepositorAvailable sinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only