We narrowed to 2,855 results for: try
-
-
-
pcDNA6-BKαM3αM4-V5-His
Plasmid#255912PurposeBKαM dual-repeat expressing plasmid in which αM3 (residues 44–649) is preceded by an N-terminal sequence (MGAAAA) containing a NotI site and linked to αM4 (residues 43–649) via a flexible linker.DepositorInsertKCNMA1 (partial) (KCNMA1 Human)
TagsV5-6xHisExpressionMammalianMutationcontains αM3 (residues 44–649) preceded by an N-t…Available sinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-SARS-CoV-2-S-Bel-P5_5-7-IRES-mNeonGreen-NES/PKI-P2A-Blasticidin
Plasmid#237480PurposeEncodes full-length SARS-CoV-2 Spike protein (Belgium/GHB-03021 isolate), featuring the E484D substitution, which likely emerged during passaging and enhances TMEM106B binding.DepositorInsertSARS-CoV-2 Spike protein (Belgium/GHB-03021 isolate)
UseLentiviralTagsIRES-mNeonGreen-NES/PKI and P2A-BlasticidinExpressionMammalianMutationS484D + S813I + deleted amino acids 68-76 + 676-6…PromoterCMVAvailable sinceJuly 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pLenti gRNA KO OCLNx2 spCas9-T2A-iRFP670-P2A-puro
Plasmid#208399Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, iRFP670 fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro
Plasmid#208400Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, mNeonGreen fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsmNeonGreenExpressionMammalianAvailable sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
LifeAct-mNeonGreen -IRES- Talin head-SpyTag003
Plasmid#210024PurposeExpression of LifeAct-mNeonGreen and Talin head(1-433)-SpyTag003 in mammalian cellsDepositorInsertLifeAct-mNeonGreen co-expressed with Talin head(1-433)-SpyTag003
ExpressionMammalianMutationEncephalomyocarditis virus internal ribosome entr…PromoterCMVAvailable sinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGA-FT guide RNA1_7
Plasmid#246797PurposeA GreenGate entry vector containing a guide RNA expression cassette targeting the AtFT gene with 7 different gRNAsDepositorInsertAtU6-1 promoter-FT guide RNA1-AtU6-1 promoter-FT guide RNA3- (FT Synthetic, Mustard Weed)
UseCRISPR; Greengate cloning entry vectorExpressionPlantAvailable sinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DW164AA + DED/AAA USP7
Plasmid#131256PurposeMammalian expression of N-terminally Myc-tagged USP7, with mutations in the TRAF-like domain (DW164AA) and UBL2 (DE758AA_D764A)DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationContains point mutations that convert USP7 aspart…Available sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPm-IFNAR1(28-557)
Plasmid#192784PurposeExpression of SNAPf and mXFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPmExpressionMammalianMutationmXFPm: tryptophan 66 to phenylalanine, gluatmic a…PromoterCMVAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR201-JIP60ml
Plasmid#104959PurposeEncodes a modified, active, form of Hordeum vulgare c.v. Golden Promise Jasmonate Induced Protein 60 (JIP60)DepositorPublicationInsertJasmonate Induced Protein 60 (JIP60)
UseGateway entry vector for lr recombination into ot…MutationReplaced amino acids 164 to 187 with a methionine…Available sinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by