We narrowed to 9,075 results for: sgRNA
-
Plasmid#127654PurposeKnock-out of human NONO (guide only)DepositorInsertNONO sgRNA (NONO Human)
ExpressionMammalianAvailable sinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-EZR
Plasmid#227293PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of EZR for knock-in.DepositorAvailable sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
PEA1
Plasmid#176527PurposeDelivers all prime editing nickase components in a single plasmidDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCbH-Cas9(H840A)-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRExpressionMammalianPromoterCbH for Cas9, hU6 for gRNAsAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-U6gRNA2-Filler
Plasmid#237401PurposeFor the sequential insertion of two guide RNAs into two U6gRNA cassettes.DepositorInsertsU6gRNA-1
U6gRNA-2
PGK-TagBFP
UseCRISPR and RetroviralExpressionMammalianPromoterPGK promoter, U6 promoter, and U6, PGKAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgPal7 (p2Tol-U6-sgPal7-HygR)
Plasmid#71484PurposeExpresses palindromic sgRNA for use in self-cloning CRISPRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgPal7
PromoterU6Available sinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFREE2-xCas9-sgRNA
Plasmid#179579PurposeExpresses xCas9 and gRNA that targets ColE1 plasmids for curing.DepositorInsertxCas9
ExpressionBacterialAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6 SgRNA GAPDH
Plasmid#162736PurposeMammalian expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpacer sequence for GAPDH
UseCRISPRExpressionMammalianPromoterU6Available sinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC8 (pP18(T)_B1-AVA4071)
Plasmid#239306PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC8DepositorInsertU6-driven sgRNA targeting EXOSC8 (EXOSC8 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC9 (pP18(T)_A7-AVA4072)
Plasmid#239307PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC9DepositorInsertU6-driven sgRNA targeting EXOSC9 (EXOSC9 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC4 (pP18(T)_C11-AVA4065)
Plasmid#239302PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC4DepositorInsertU6-driven sgRNA targeting EXOSC4 (EXOSC4 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato90/816
Plasmid#179918PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 90 and 816.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry empty
Plasmid#80975PurposeCas9, mCherry, and sgRNA expressionDepositorTypeEmpty backboneExpressionMammalianAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-miR122 TS
Plasmid#209783PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoter, incorporation of the miR122 target sequences (miR122TS) into the 3’ untranslated region (3’ UTR)DepositorInsertmiR122 ts
UseAAVTagsHAPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lenti.Cas9.BFP.sgRNA.parental
Plasmid#196715PurposeSortable WT-SpCas9 expression and guide cassette (1-vector system).DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA-Dual_filler(hU6_H1)-EF1a-Thy1.1-P2A-Neo
Plasmid#239608PurposeBackbone for the cloning of a dual sgRNA expression plasmid (hU6 and H1 promoters) using BsmbI. Selectable with a G418 resistanceDepositorInsertfiller-trcr-H1-filler
UseCRISPR and LentiviralAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only