We narrowed to 3,286 results for: cat.3
-
Plasmid#227492Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-PrPro
Plasmid#227456Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-36kb-USF
Plasmid#227464Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro SPNS1_sg1
Plasmid#218530PurposesgRNA targeting human SPNS1DepositorInsertSPNS1 (SPNS1 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_HOMER3_WH1
Plasmid#109891PurposeProtein expression and purification of HOMER3_WH1DepositorInsertHOMER3_WH1 (HOMER3 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_MYL6_EF-hand
Plasmid#109794PurposeProtein expression and purification of MYL6_EF-handDepositorInsertMYL6_EF-hand (MYL6 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
IF405: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-p300core
Plasmid#121825PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the p300 catalytic core for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/p300core (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA[bTub+DsxF].1046A
Plasmid#112694Purposeexpress two gRNA targeting bTub & DsxF under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] & U6.3-gRNA[DsxF] (dsx Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
AP56-6
Plasmid#65593Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-5
Plasmid#65591Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-8
Plasmid#65596Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-7
Plasmid#65594Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-FLAG-METTL3-APPA
Plasmid#160251PurposeExpress catalytic inactive FLAG-METTL3 in human cellsDepositorInsertmethyltransferase like 3 (METTL3 Human)
TagsFLAGExpressionMammalianMutationchanges in aa 395–398, DPPW → APPAPromoterCMVAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
VIPR2-Tango
Plasmid#66521PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
OPRL1-Tango
Plasmid#66463PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
XLone-UCE mutant
Plasmid#242185PurposeExpress doxycycline inducible UCE 32S binding mutation of CRNDE in mammalian cellsDepositorInsertCRNDE UCE mutant (CRNDE Human)
ExpressionMammalianMutationATTTTCATGGGC to TAAAAGTACCCGPromoterTRE3GSAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
ELL2mRNA+polyA
Plasmid#127256PurposeFor in vitro translation of human ELL2 with 30 nt pA tailDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationshortens 3'UTR to 40 bp adds A30 tailPromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-cfSec15A_5
Plasmid#26716DepositorInsertDog Sec15A RNAi (EXOC6 C. familiaris (dog RNAi))
UseLentiviral and RNAiExpressionMammalianMutationDog Sec15A-specific RNAi.Available SinceDec. 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-shGrm2-2344
Plasmid#120725PurposeLentiviral vector that expresses GFP and an shRNA targeting Grm2 (in pLL3.7)DepositorAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only