We narrowed to 16,087 results for: grna
-
Plasmid#139330PurposePlasmid expressing a sgRNA to introduce BRCA1 E1754K using base editingDepositorInsertsgRNA to insert BRCA1 E1754K using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA FANCD2 Q223Stop
Plasmid#139332PurposePlasmid expressing a sgRNA to introduce FANCD2 Q223Stop using base editingDepositorInsertsgRNA to insert FANCD2 Q223Stop using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LMX1B-gRNA-C-del
Plasmid#131516PurposegRNA to delete a nucleation site near Lmx1b. Use with LMX1B-gRNA-N-delDepositorInsertLMX1B-gRNA-C-del
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
LMX1B-gRNA-N-del
Plasmid#131333PurposegRNA to delete a nucleation site near Lmx1b. Use with LMX1B-gRNA-C-delDepositorInsertLMX1B-gRNA-N-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SKOR1-gRNA-C-del
Plasmid#131332PurposegRNA to delete a nucleation site near Skor1. Use with SKOR1-gRNA-N-delDepositorInsertSKOR1-gRNA-C-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SKOR1-gRNA-N-del
Plasmid#131331PurposegRNA to delete a nucleation site near Skor1. Use with SKOR1-gRNA-C-delDepositorInsertSKOR1-gRNA-N-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
EZH2-Promoter-gRNA
Plasmid#131329PurposegRNA to generate endogenously tagged -tetR-EZH2DepositorInsertEZH2-Promoter-gRNA
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
gRNA telo/GFP
Plasmid#137713PurposeVector co-expressing sgRNA telo and GFPDepositorInsertsgRNA telo + GFP
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianPromoterU6/RSVAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-3
Plasmid#133403Purposehuman ETV6 gRNA-3 is a 20-nt gRNA expression plasmid targeting the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL436 HEK293site3EQR sgRNA
Plasmid#126445PurposeTo cut the human HEK293 site3 locus for integration.DepositorInsertspacer against human HEK293 site3 with NGAG PAM
ExpressionMammalianPromoterhuman U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLK4 G8.1 gRNA
Plasmid#90837Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorInsertPLK4 (Guide Designation G8.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLK4 G7.1 gRNA
Plasmid#90836Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorInsertPLK4 (Guide Designation G7.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MIS18BP1 F10.1 gRNA
Plasmid#90769Purpose3rd generation lentiviral gRNA plasmid targeting human MIS18BP1DepositorInsertMIS18BP1 (Guide Designation F10.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MCM6 E1.2 gRNA
Plasmid#90762Purpose3rd generation lentiviral gRNA plasmid targeting human MCM6DepositorInsertMCM6 (Guide Designation E1.2)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MASTL F4.1 gRNA
Plasmid#90753Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation F4.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
DYNLT3 B3.5 gRNA
Plasmid#90670Purpose3rd generation lentiviral gRNA plasmid targeting human DYNLT3DepositorInsertDYNLT3 (Guide Designation B3.5)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
DYNLRB1 H11.3 gRNA
Plasmid#90664Purpose3rd generation lentiviral gRNA plasmid targeting human DYNLRB1DepositorInsertDYNLRB1 (Guide Designation H11.3)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFGRNA-LbCpf1-SpCas9
Plasmid#119673PurposeEmpty vector for cloning LbCpf1-SpCas9 fgRNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFGRNA-AsCpf1-SpCas9
Plasmid#119674PurposeEmpty vector for cloning AsCpf1-SpCas9 fgRNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only