We narrowed to 3,249 results for: cat.3
-
Plasmid#64638Purpose3rd generation lentiviral transfer plasmid. When used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pOTTC1080 - prRosa26v2 LSL FLAG-SpCas9
Plasmid#113163PurposeA donor plasmid with homologous arms matching rat Rosa26 and expressing a Cre-dependent FLAG-tagged SpCas9DepositorInsertSpCas9
UseCRISPRTagsFLAGExpressionMammalianPromoterCAGAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMMS22L-siR3
Plasmid#221013Purposemammalian expression vector of myc-Flag tagged MMS22L siRNA resistantDepositorInsertMMS22L (MMS22L Human)
TagsFlag and mycExpressionMammalianMutationsilent mutations MMS22L: 5'-aaAacGtgTtgCtgTg…PromoterCMVAvailable SinceJuly 31, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOTTC763 - pX458 with rat Rosa26 gRNA A
Plasmid#113161PurposeA plasmid that expresses a guide RNA targeting rat Rosa26 as well as FLAG-tagged SpCas9 and GFPDepositorInsertgRNA for rat Rosa26
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1124 - pAAV MeCP2 SpCas9(D10A)
Plasmid#112719PurposeAn AAV vector that expresses SpCas9 nickase under a neuronal cell promoterDepositorInsertSpCas9
UseAAVMutationD10APromoterMecp2Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-MKK6 (S207E,T211E)-pcw107
Plasmid#64625Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceJune 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-YAP2 (8SA)-pcw107
Plasmid#64637Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
p3E mCherry-T2A-hsHRAS-G12V-pA (JDW 1188)
Plasmid#242571PurposeGateway 3' entry clone containing mCherry followed by a T2A cleavage peptide and then human HRAS G12V.DepositorInsertHRAS-G12V (HRAS Human)
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-ARID1A-deltaIDR2-FLAG
Plasmid#242215PurposeExpression of human ARID1A ∆IDR2 (deletion of a.a. 1170-1610) using piggyBac transpositionDepositorInsertARID1A (ARID1A Human)
UsePiggybacTagsFLAGExpressionMammalianMutationDeleted IDR2 from ARID1A (deletion of a.a. 1170-1…PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-ARID1A-deltaIDR1ARID-FLAG
Plasmid#242211PurposeExpression of human ARID1A ∆IDR1 and ∆ARID (deletion of a.a. 2-1169) using piggyBac transpositionDepositorInsertARID1A (ARID1A Human)
UsePiggybacTagsFLAGExpressionMammalianMutationDeleted IDR1 and ARID from ARID1A (deletion of a.…PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c4X-MBP-ARID1A-IDR2
Plasmid#242216PurposeExpression of MBP-tagged human ARID1A IDR2 (a.a. 1170-1610) in E. coliDepositorInsertARID1A (ARID1A Human)
TagsMBPExpressionBacterialMutationARID1A IDR2 (a.a. 1170-1610)PromotertacAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1079 - pAAV TH gRNA A EF1a EGFP
Plasmid#113159PurposeAn AAV vector that expresses guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
HRas (G12V, E37G)-pcw107
Plasmid#64639Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
HRas (G12V, E37G)-pcw107-V5
Plasmid#64640Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertHRAS (transcript variant 3) (HRAS Human)
UseLentiviralTagsV5MutationG12V, E37GPromoterPGKAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-TRAC-CD19.CAR-Cas12a.PAM.mutated
Plasmid#215769Purposeencodes for HDR template for optimized AsCas12a-mediated knock-in of a CD19-specific CAR into the TRAC locusDepositorInsertsExpressionBacterialMutationCas12a PAM mutatedAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
P530_SIX6-p2A-h2b-EGFP
Plasmid#239101PurposeHuman donor plasmid for integration of p2A-h2b-EGFP into the 3' end of SIX6. This includes the donor casette and a U6 driven guide sequence to be used with Cas9.DepositorInsertSIX6 (SIX6 Human)
UseDonor plasmidTagsp2A-h2b-EGFPExpressionMammalianPromoterEndogenous SIX6 promoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-ARID1A-deltaARIDIDR2-FLAG
Plasmid#242214PurposeExpression of human ARID1A ∆ARID and ∆IDR2 (deletion of a.a. 971-1610) using piggyBac transpositionDepositorInsertARID1A (ARID1A Human)
UsePiggybacTagsFLAGExpressionMammalianMutationDeleted ARID and IDR2 from ARID1A (deletion of a.…PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-ARID1A-deltaIDR1IDR2-FLAG
Plasmid#242213PurposeExpression of human ARID1A ∆IDR1 and ∆IDR2 (deletion of a.a. 2-970 and a.a. 1170-1610) using piggyBac transpositionDepositorInsertARID1A (ARID1A Human)
UsePiggybacTagsFLAGExpressionMammalianMutationDeleted IDR1 and IDR2 from ARID1A (deletion of a.…PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only