We narrowed to 6,178 results for: cas9 expression plasmid
-
Plasmid#232093PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Nat
Plasmid#232090PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Kan
Plasmid#232092PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 omega1 Tnos:BASTA:Pnos - P35S:hCas9:Tnos (GB3469)
Plasmid#160647Purposemodule containing the human codon optimized Cas9 and the BASTA selection markerDepositorInsertBASTA / Cas9
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnos, P35SAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
IGI-P0492 pHR-dCas9-NLS-VPR-mCherry
Plasmid#102245PurposeLentiviral expression of dCas9-VPR-mCherry fusion protein for CRISPRa.DepositorInsertdCas9-VPR-mCherry
UseCRISPR and LentiviralTagsNLS-VPR-mCherryExpressionMammalianPromoterCAGAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
Nsp2Cas9_AAV
Plasmid#192143PurposeExpresses Nsp2Cas9, and cloning backbone for sgRNADepositorInsertNsp2Cas9
UseAAVExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
NarCas9_AAV
Plasmid#192145PurposeExpresses NarCas9?and cloning backbone for sgRNADepositorInsertNarCas9
UseAAVExpressionMammalianAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CK8e_Cas9_miniPA
Plasmid#226141PurposeAAV construct for HITI insert with CK8e promoter and SpCas9DepositorInsertCas9
UseAAV and CRISPRExpressionMammalianPromoterCK8eAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9_GFP
Plasmid#44719PurposeCo-expression of human codon-optimized Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cellsDepositorInsertCas9-2A-GFP
UseCRISPRTags2A-GFPExpressionMammalianPromoterCAGAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP
Plasmid#118156PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-EGFP under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVH321-1-Tier1-PhCMV-dCas9-3xNLS
Plasmid#169595PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS expression (PhCMV-dCas9-3xNLS-pA).DepositorInsertdead S.pyogenes Cas9
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gCD44v2)-EF1a-BFP-Puro-Cas9(FZ)
Plasmid#117134PurposeAll-in-one expression vector for Cas9 and gRNA against CD44DepositorInsertgCD44 v2 (Cd44 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, human EF1a promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-NED
Plasmid#109358PurposeMammalian vector for expressing effector domains fused to dCas9.DepositorTypeEmpty backboneUseCRISPRTagsdCas9, SV40 NLS, 3xFLAGExpressionMammalianPromoterCMVAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR
Plasmid#118154PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationSee depositor comments belowPromoterEF1a core and U6Available SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVi U6_gRNA CMV_SadCas9-KRAB
Plasmid#214609PurposeAll-in-one AAVi plasmid expressing S. aureus dCas9-KRAB with sgRNA cassetteDepositorInsertsgRNA
SadCas9
UseAAVTagsNP NLS and SV40 NLSExpressionMammalianMutationD10A, N580APromoterCMV and U6Available SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only