We narrowed to 12,613 results for: cel.2
-
Plasmid#173949PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgLIAS-2
Plasmid#251682PurposegRNA to knock out LIAS in mammalian cellsDepositorInsertLIAS lipoic acid synthetase (LIAS Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgETS1-2
Plasmid#251686PurposegRNA to knock out ETS1 in mammalian cellsDepositorInsertETS1 ETS proto-oncogene 1, transcription factor (ETS1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-sgCDKN1B#2 BFP
Plasmid#60905PurposeA lentiviral plasmid that encodes both a sgRNA targeting CDKN1B and BFPDepositorInsertBFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 2
Plasmid#207610PurposesgRNA 2 to knockout TR by replacement with a PuroR cassetteDepositorInsertTCAGGCCGCAGGAAGAGGAA
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
EED-KO-gRNA-2
Plasmid#131322PurposegRNA to knockout EED. Use with EED-KO-gRNA-1DepositorInsertEED-KO-gRNA-2
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-3JB1F+2
Plasmid#190833PurposeFor mammalian expression of 3JB1F+2, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1F_T1+2bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSuper.Retro.Puro-WDR5 shRNA 2
Plasmid#59975PurposeKnockdown of WDR5DepositorInsertWDR5 shRNA
UseRetroviralAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
JARID2-KO-gRNA-2
Plasmid#131327PurposegRNA to knockout JARID2. Use with JARID2-KO-gRNA-1DepositorInsertJARID2-KO-gRNA-2
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-3JB1R+2
Plasmid#190840PurposeFor mammalian expression of 3JB1R+2, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1R_AP3+2bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
GST-PC-2-CTS
Plasmid#86068PurposeA bacterial expression plasmid encoding polycystin-2 ciliary targeting signal with N-terminus GST-tag.DepositorInsertPolycystin-2 (Pkd2 Human)
TagsGSTExpressionBacterialMutationcontains the region from 1-15PromotertacAvailable SinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.2-AP-His
Plasmid#72043PurposeExpresses the extracellular region of the Sema6D, isoform 2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.2-Fc-His
Plasmid#72169PurposeExpresses the extracellular region of the Sema6D, isoform 2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
FH1-PNGT#2-mCherry
Plasmid#164099PurposeFluorescent reporter for genetic tracing of proneural Glioblastoma cell-state.DepositorInsertPNGT#2-mCherry
UseLentiviral and Synthetic BiologyAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
FH1-MGT#2-mCherry
Plasmid#164097PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#2-mCherry
UseLentiviral and Synthetic BiologyAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgNCKAP1-2
Plasmid#210134Purposeknock out NCKAP1 in mammalian cellsDepositorInsertNck-associated protein 1 (NCKAP1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS-shCHD5 #2
Plasmid#68877PurposeCHD5 shRNA expressed from Adeno-associated viral (AAV) vectorDepositorInsertCHD5
UseAAV and RNAiExpressionMammalianPromoterH1Available SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-ZIM3-KRAB_sgTAOK2i_#2
Plasmid#172984PurposeCRISPRi for TAOK2DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-KRAB_sgSTK4i_#2 (PuroR)
Plasmid#209774PurposeCRISPRi for STK4DepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only